Description :
From Genome Similarity Track
Location :
Scaffold_7:141521- 142842
Sequence
1321 bases(100 bases per row)
TAGCCGCATCCACAACCACCCAGCTTCGTTGGATGTCCGTGTTCACTCTGGTCACCGGCGCCGCAGTGCTCAACAGAATACGACTGCTCAACTTTCAACT
GTGAATGATTTGATTTTTTTTTCAAACTGCTGCAGGCGTTCCTGTGTCCAAAGTATACGCTACCCTACTGCTATCCGACAAAACCTCTCTTGTAATTCCG
AAGGACATTGCAAACACTAAAGACACAAGGCGCAGAGACATGCTAGCAACAGACACAGCAATTGAAGCTCTTTTCCTCAAACTTACCGAGCATGGATTCT
ACTACAAGTACGAGGTGGACCCTGAGTCACGACGCTTAAAATACCTGCTGTGGGCCCACCCTGACACTATAAACTTGGCACGACATTACATGGGTGTCGT
TGTTATGGACTGTACATACAAGACAAACAAACACAACTGGCCTCTGTGCAACATAATTATTCTCACTGGGTTGAACAAAGTTCTCCCTCTTGCTCAGTGC
TAGCTACCAGGCGAAGCCGAGGCCGACTACACGTGGGTTTTCAACCAACTAAAGCTTCTTCTGTTAGCAAATAGCGTGCAATTGCCTCGAATTGTCCTCC
CATTTCTCGTAACAGACCGAGACCTTGCGTGTATGAATGCAAGCGACGCAGTATATCCTGAGATCCCTAAAATTCTGTGTCGCTGGCACGTCAACCGAAG
GGTTCTGGCGCGCGTGCAAGACGACCTCGGAATTATACGTTTATCTAGACCGGGACCGAACGGTGAAATGAAACATAATTCAGTGGAGACGGATGTATTC
ATGGCTAAGTATTATGAGGCAGCTGCGTCCGAGTCGGTGTCTAAATTCGAAGAGCATTGTGCGGTTTTACGAGGCCTTAGCAGTTCTACCGCTGAATATC
TAGAACGGACTTGGTGGAAATATAAAACCAGGATAATCAAATGCTGGACGGATCGACATGTTCATTTCGGCTGTCACGACACGTCCACCGTTGAAGGCAC
TCATGCGAAGATAAAACGGTGGCTGGAGACCTCGAAAGGAGATTTATTGACCGTTTTCGTGAAGCTTCTTCCCTGGTGGAACGCTTCCGCTAAAACTATC
ACATTTCAGTCCGCACAAGATGCCACAATCGTTCCTCACAGACTTCGGTGGGACCAGTACTCTGCTGTTGTTCGGGTGATATCTACGTACGCACTCATGG
AGACTGACAAACTCTGGAGAACCGCTCGTAACTTGGTCACTTCTGGTAGCGAAATATCATCATGTTCAGGGGTATTCAGACTCACTCATGGAAGACCATG
TCTTCATGAACTGGTTGCAAT