Description :
From Genome Similarity Track
Location :
Scaffold_2244:1415- 2849
Sequence
1434 bases(100 bases per row)
TTCACTTCTTCCTCGCAATCCACTCCTTTCCTGTTGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCA
CACCCTTCCTGTGGGCCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCAATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGA
ATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCA
ATACACCATAAAAAAATTCACGGTAAATTCGTCCGTATCTAGTTCGCTTCCCCGACCTCATACCGGTGATCTTCTCGACTTCGAACTCGTCAGCTTCGAG
ATCCACATTCCAACTATCTTCCGGTAAGAGGATTTCGTCGAAGTCGACGCGGTCGGATCCACCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCT
TTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGG
TCCGTGCCATAGATGGGCCAATTTGCGGGTGTACCCTTTTTCTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGTTTTGATGTGATCGGGC
GTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATGTAGCTTGCTGGTAGTATTTCTGGACTTGGTATCGC
CATCCCCTTGGATCTCGGTTCTCTTCTTGGTGCTACATACCGGAATGACCGCTTCTAGCGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGT
ACCACACCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGTCGTTCTGCGTACGCATCCTAAACCCTCTGATCCAAATCCTGGACATACAGCTTG
AGTGCTCTCGTGATCGTCTGCACCATGCGCTCGGCTGACCCGTTAGCTTGGGGACGATATGACATGGTTGCTCGCTGTCGCTTCCCCAGGATCCGGCTGA
ATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGC
AATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTG
GGCAACGAGGGGATATGATCCATGGCTATGATTTCGAAAAGGTAAGTCGCTTGGACATTCCCGGGTGACTCCCCTTCGACTGTGGGCCTGCCCTTGCCTG
TCTCACAATCCACGCATTCACCGACATATCGTTG