Description :
From Genome Similarity Track
Location :
Scaffold_1505:1415- 2709
Sequence
1294 bases(100 bases per row)
CGTAAGAGAATACGTACCGACAGTACGGGCGAAGACGCCCCACGTAATCCGTAGGAGGCGTGGGGCGTCGTCCTACGGGGCTGCTTGATCGTGAATGCGT
TGCCTTGGCGGTGTACTACACGACAGGGCCCAGTGTACTTGGGTAGTAGAAAACTACTACCCACGTTATTCACTGTATGTCTGGGTAATTTATCCGTAGA
AAGTAGGACTAGGTGACTAACGATTAATAGAATCACATTTGATCTTCCATTCTTGTCAGCGTTCCGTTTCTGTAGGTCCACTGCGTTAGCGATGGAGACC
TGTACGAAACGGATAACTGCTTCTCGAGTCAGCAGAATTCATTTGTTGACTCGGCTTTGTTTGATCCAGTGCGCTTAGTGTGCACTGTGAATTTAACGTT
GTTTTCGTCAGCGAGGGCGTCATCGTCCTCGCTGGAATAGCCATTGGCGATGATGAATATACTAGCATCATCATTACCATCATAGTCAGTGATATCTTCC
TTGATGTCACTGTGGTTATCTTCTTCGATGTCGATTAGTCGTCATCGGTGTCCTTCGCGGTGACGTTCAAGAGCCAGAACGGTTTTTGCTCGAGCGAGTC
CCTCCCCTCCTTAAACCAGAGTCACAATCTAATAAGGCTGGGATACGTGGATGGCGCAAGCCATCCCGAAGAACGGTGTATGCGTCGCGACGCATGCACC
GAGTTGGGTTGATGGCAACTGTCTGCCATCACCAAGGACCCACTCCAAATCGATAACGAGTGATTTATTATCGAAGTAACCCGTCGATTGTACATACGCA
CAGTAGCTCAACTGGGAAGGCATGGCAACGTCATCCCAGAGGTCACTGGTTTGATTTACTGTGGGGGAAGAAGATAAGCCTGCGGGATCTGGTGTGATGG
GGTTCACCAGCACTGTCCTGACAGAAAAAGTGACGCCCCCCACTTTTGTGGGACACGAATACCGATCCGTCTGACCATCTACTCTAAGATGGTCAGAAGT
TGGCATCTTGTTCCAAGAGTATGGAACACGGATAGCCAAACTCTGCCATGAACCGCGGATTTATATCCGAGATCAGTCCACGGGGTGAACCGTGGAGTCA
AATGGACGTGTCAGTAAAGACACGAGCACAGCCCTCGACATTGATTGACTCTGTTACAGCAACAAGATGTACCATCTTGCTGAATCGGTCAACAAACACA
AGAATACCATGTGGTCGTCTTCCAATATTACGAAGACGAAGTCCATTGACACGGACTGCCAGCATTCTGCCGAAACAGGCAGAGGCTGGAACGG