Description :
From Genome Similarity Track
Location :
contig_16:141499- 144068
Transcript NameFunction/comments
g3571.t1hypothetical protein

Sequence
2569 bases(100 bases per row)
GCGTGTATGGCAGGTAACCAAATCTGACAACGACATGAGCTACTGGACACAAAATAAAACAAAACCAGCAGGCCTAGGAATTCTAGCCAGCCCAGCCATC
AGCGCACGGATAAAACCTTGGTAGCAAGCAAGGTGGACATCACGTGTAATAGCAGTGGAACTAGATGACTGACTAATAGTAAATGTATATGCACCAGCTC
AACGAAGTGAACAAGACCAATTCTACGCCGACCTCGAACCTTGGATATCTCAACACAAATCTGTGATCATCGGAGGAGACTACAACTGTGTACTGACACC
ACATCAAGATCGCATAACTGGACGCAAGCCCAGCTCGTCCCCGAATGAAAGCAAAATACTTCAAACGATGCTGGATAAATGGGATTACTCCGACGCGATC
AGCCTCACCAGACACCTCAACGACGAGGAAGAAGACCATGACCCAATGCATTTCTACACATGCTGGGCCCAAGATGGAGCCAGCAGACTAGATCGCTTCT
ACGTAAAAGGTGAACCATTCACAGCGGTACAGTGGGTTGATGTAATAACCGCAGCACACGACTCCGATCACGGAGAAGTACGACTCGAGCTATCCACAGG
AAAGCAAGCCCCACGAACCGGAAAACAACAAATCCACTACACAATCCGCACAGGACGACCCACACGTGTACCACAAGCAATAGCCACCGGCTTAGCAGAG
GTAATGGAGTGGTTTCAACAGGCAACCAACGCTATTGAAACATGGGGTCACATCACAGAAGAAATACGACAACTACTACAAAAAGTGAAACGACATGATG
ACAAACAAAGTCGAAGATACTTTGAAAACCTGTGAGCATCAACAAGAACGGTTAGAACAACTAGAGCAGAGATCCATGAAGCAGATCGAAAAAAAACACG
AACCAGAGCGGCAAGATCCTTCGGACAACACCTACAACTGACAACAGAAAACACACGGCGCCTTTTCAAACTAAACTCAGACTGCCAACGGGATCAAACA
ATCACAACAATCGACTCGTCACCTGGACACTTTTACGCGGATGAATACCCAGTGGAAGAGAGAATGGCGTCCGAGTGGAGCCACGTCTTCGGACAGTCTC
ACGCAAAAGTGGAGCCAAACAGTAGAGAAGAGACGTTCAAACAATTTGTTACCATCCCCGAAAGCCACAAATTCACACCAGCAGAAGCCGAAAAACTAGT
GAAGCAGATCTTGGAAGGAGAAACCAGAATGGCGATTGAACACCTAAATAGGAACAAGTCAGCTGGAACCACTGGACTAAATCACGATTTCTACAAAGAC
TTTCAGAACGAACTCACACCAGGACTCACTAAACTTTTTAACGCTTTTCTGGATGGAGCAGGGTACGTACCACAAACGTTCCTAGACGCGACCGTAGTCC
CACTTCGGAAAAAGGGGGACTCAGCGGAAGCAATGGACTACAGACCAACAGCTCTCCTCAACACAGCATACAAAGTTTTCGGGCGAATATTAGCAGAACG
ACTACATCAACTTCTACCCAAATTAATTAGTGCAGCGCAGCAGGGGTTTGTCAGAGGACGATCTATCGACAAGACAATAACCATACTACGAGCAATACTA
GCAGAAAGCGAACACAACCCAACCAAAGCATGGGCAGACTTTGCGGCAGTACTAAGCTTAGACCTACGGAAAGCGTACGACACGCTAGATCTGGCATTCC
TCCTCATGGTCCTGAGACGATATGGATTCTCGGAAAGGTTTATAGCAGTGATACAGCGACTACATAATAGAACGACAGCGATCATCTTCTTGGTTAACGG
GCAGTTATCAACTAAATGGACAGTGGCTTCGGGCATCAGACAAGGATGTCCTCTCGCGCCACTCTTGTTCATTCTGGCGGTTGACATGCTCAGCAGAGTA
ATCAACCAACATCCAAACCTAACGGGATTAGCCATCCCTGGCAGCAAAACGCTCCACTATAAATTCTCAGCATTTGTTGATGCAGCACAGTGTACTTGAA
ATCAGCGAAGGAAATACCGATTGTACAGAAAATCCTGAAGGCGTTTGGGGAATTATCTGGACTACAAGTACAACCGCAGAAAAGCGTACTAATAGGATTG
AACACGGCTGGGACTCCTACGAAATGGCATAGATTCCTGGTGTTACAACCAAGAAGACAACAAGATATAGGGGTACTGGGTAGGAAACTCAGATCCAACC
ATGGAGAACTGGAATATTCGGATCTAAAAACTACAACGACGCCTTCGAATCGCGACCACGGTGGGCAACTCGGTAATACAACGCATAACGCTCTTCAATG
CAGTTGCACTGCCAGCCATACTGTACACGCGCAAACAATATGTGCCACCAAAACCCGTAATTAGTAGACTCAAAATATGTAGAAGCAAGAACAGAATCCA
GCAAGCACAAAATCAATCCGGCACTGCTACTTACACCCAAGACAGCAGGCGGTCTCGGCCTACAGGACATAGAGAGAGCCCTCAAGGCGACCAGGAGCAA
TTTGGCGGAACGATGGATCAACACACCGGCAGACGAATACACGGAAGCGTGGCATGCTCTCGTGCACCC