Description :
From Genome Similarity Track
Location :
Scaffold_2:141433- 143353
Transcript NameFunction/comments
Phyci_75819Hypothetical protein
Phyci_207020Hypothetical protein
Phyci_88966Hypothetical protein

Sequence
1920 bases(100 bases per row)
AGAGGCTGAGAGTAGCGCAGAGATCGAAGAGAGCATGGCGGAAGAGGTGCCAAGCGGGTCCGAACTGGAGGAATCAAATTTTACAAACTATGAGAATGAG
GAGAGCCAAGACTATCGTCCCCAAGCTATCGAGCAACCCACTGATCTCTACTCGGAACGGCAGCAAGGGAAGTTCCCAGGGGACGATGGCCAAGACGAGG
GTCAAAACAGGGATGACGAAAGTAATGATGAGGACTCCGTGTCATTGGCCGCACCTCCTCCAGCACCCGCAAAGCTACCGTCCTTGCCACCTCTGGTTGG
TACATCACATGGAACCAATGCTGGAGATACAGAGGACGATTTCGATGCAGTAAGAGCAATCGAGATATTCGGGGATTTTGTCGAGACCTAACTGTTTCTG
TTTGTCTAATGTAGGAGGAAGAGGCAGAACGGCTACGGAAGCTAGATGCTGCATTACAAGCCATGGAGGCGGAAGACGACACAGGCACTCTCCAGCAGTT
GAAAAAGTCATTGCAAATGGAGCTCCAAGAGCAGGATAGTTTGGTAAGTAGCGGAGGGATCGGCAAAGCGGAAGAGGACAACGACGCAGAGACCGAGCCA
CCAGCAAACAAAAGCCAAGACGATCAAGAGGGTGATGACGATGGATACGGAAGCAGCGACTTCGAAGAAGAGGATGAAATTGCCAGGTACGAAGCGCGCC
TATTGCCGTAGTACTTCAAAAATACGCTGCACGGTGCTGACCGAATGTATGTTGCTTCCTCCAGCGAGGTTTCGGAGGAGATGGAGTCCATGCCAGAGCT
CTCGGATAAGGAAGATGAAAGCGAAGATGGAGCAGCCACGTCAGCGGCAGAGATAGGGCCACCTAGCACACTTCGAAACGATACCCGGGTTGATAGTGAA
GATGCGTTGAATAGCTACGACTACATCGAAGAAGTTGAGAAGGGAGGGTGGTAACACGCTAACTAGAGTGATGTCACCAAATAAACTAAACGCATGACGA
TAGTGAAAACTCTTTGAATCGATCTAGGTCTATAGAGCGACACTTTAAGATCGCCTCTCTAGTTTTCAAGTTCGACTTACTTGCGCTTTCCAGCTCCAAC
AAGCTTGTTCAGCAGGCTCTGGTCCTCGAAAGCCTCTGGGTGAATGAAATAGTGGCGGTCACGGGCCTGGAAAGACACCATGGGGTGCATCGCCTGGGTA
GGAGGCGACACCTCGGACAGTCGGAACGAGCTCTTCTCCAGCTGAGCAAACAGCGTTACCGTCTCCACCGTCACGGTGCGATCATCCTTCGTCTCCGCTG
CATCAGTTGCGTCCGCCGACGAGTCCGCCAGCCACATCCGCATCACGTATGGCTTGAACAGGTAGTGGAACAGCGACGTCGTGCCCAAGCCAAACAGCAT
GATGGTGCCGCACATAGCCCACTATTGGAACAGAACAGCAATTGCATCAGTAAGTTGCCACTGATACCAATGCAGAAATCCTACAGCCATCGACCACAGT
GTGTTTACCTTGCCGACGGCGGACGTGTCCTGCTCGCTCAGCACGCAGAGCACCGGCATGCCGATCGACGTGAGGGTGCAGCTGGTGACGGACACCGCCT
TCATGAGGCGCACGGCACGCGACATTGGCGCCTGGTACACCTGATCCCCCTCCAAGGCCATCTCGGTCTGCACCAGCGTCTCTTTCCCCCCCTCGCGCGC
GTCTTCATCGGTAAGGGACGAACTGAAGTAGCGAACGGTGAAGGGTCCACTGGCTCCGATGCTGCGGCGGCTGTGGAACTCGAACGAGAAGCGCTGCAGC
GCGGCTGCATTGACTGGACGGCTGGCGACGCGGGAGACCGTGTGAAGCGACTGGAGAGAAGGAGACAGCGCCTCCGCGAGCCGCGCGGCGCGGTGCGTCG
CTCGGAAGACCAGCATCGTC