Description :
From Genome Similarity Track
Location :
Scaffold_292:14142- 15143
Transcript NameFunction/comments
g17493.t1hypothetical protein

Sequence
1001 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCAAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTGCCCCTGCCGGTGTTATCGGCGTTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGG
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCATGTTATTCGTTGTCGTTTG
AAGTGTCTACGCCCGTCGTAGACACTGTGTTGTCGTCGCCATGACTGCGCGCAGTACTGCGCGAGTCGTTACAGCTGATACATTGCTCGTATCAGCGTGC
TTATCCGGTTGTTTTGAATTAACAGGATATCCTCCTCCATTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGCACGCGTGGGTGCCTCATGGCATTCA
CGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTA
GCTCTTCATGGTGTCAACCAGCACGCGGCTGACACGCTCTGTTTGTCCGTTAGTCTGTGGGTGATCTGCAGTTGACATGGCAACTGCGTCCCAAGAAGTG
TAAACACTTCTTGCCAGAGTCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCAGGTCAACAAACAG
ACATGCCGTCTGTTCGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCCTCCGCTTG
T