Description :
From Genome Similarity Track
Location :
Scaffold_595:1414- 3285
Transcript NameFunction/comments
g16157.t1hypothetical protein

Sequence
1871 bases(100 bases per row)
CTGAATCCAGCGATCCGGGTTCAAATCCCGGTAGGAGCTCGTTTTTGTGCGGCGAAGCAAGCGTGTGGTGTGTGTGAGTGGGTGATGGCTGTGTGTGGGT
GGTAGGTGTTGTTTGAGAATGTGTTGGGGGATAGGCAAGTTAGTGCTGGTCTTATGGTGTAATGGTTAGCACTCTGGACTCTGAATCCAGCGATCCGGGT
TCAAATCCCGGTAGGACCTCGTTTTACACTCATCCTGCCGGCAGCACCACGCCCCCGTTGTTGCTCCAGCGCGGACCTACTACACACCCGTCTCAGCGCG
CTGTGTGTCGCTGTCTGGCCTCTTATCGCACCGCAAGCGACCGGGACCATGCCTGTCATGTGGTGACCTCGGGCAACCAGTGGTGAAGCTCGGCTTCTCG
ACTTCTCGGCGTCTTGACTTCTCAGCTCGCTCATCGTTCGACTGACCGCCTCCGACGGGCACCAGACGGCGGACGGCGAGCAGCCATGCAGGGAGGGAGG
GACCCATGACACCACACCACACGTGGAATCGCGGCCGAATTCGAGCTGGGAAGAGGCCGACAAGCTGATTGTGGGCGGCGGGGATCGAAGCGGGTGGTCG
GCGGAATGGGCGTGTGGATGTGGCTTCGGGTCGTGGGAGACCGCTACAAGGCGACGATGGCGCGGCTAGCGTCCATAGGAGAGGTGCTGGGAAGGTTGTT
GCGATATTCGAGCGGGTTCCGGAGTGGGTGTGCAAGGGCTGGGTTAGGCGCTCTTATGGTGTAATGGTTAGCACTCTGGACTTTGAATCCAGCGATCCGG
GTTCAAATCCCGGTAGGAGCTCGTTTTTGTGCGGCGAAGCAAGCGTGTGGTGTGTGTGAGTGGGTGATGGCTGTGTGTGGGTGGTAGGTGTTGTTTGAGA
ATGTGTTGGGGGATAGGCAAGTTAGTGCTGGTCTTATGGTGTAATGGTTAGCACTCTGGACTTTGAATCCAGCGATCCGGGTTCAAATCCCGGTAGGAGC
TCGTTTTACACTCATCCTGCCGGCAGCACCACGCCCCCGTTGTTGCTCCAGCGCGGACCTACTACACACCCGTCTCAGCGCGCTGTGTGTCGCTGTCTGG
CCTCTTATCGCACCGCAAGCGACCGGGACCATGCCTGTCATGTGGTGACCTTGGGCAACCAGTGGTGAAGCTCGGCTTCTCGACTTCTCGGCGTCTTGAC
TTCTCAGCTCGCTCATCGTTCGACTGACCGCCTCCGACGGGCACCAGACGGCGGACGGCGAGCAGCCATGCAGGGAGGGAGGGACTCATGACACCACACC
ACACATGGAATCGCGGCCGAATTCAAGCTGGGAAGAGGCCGACAAGCTGATTGTGGGCGGCGGGGATCGAAGCGGGTGGTCGACGGAATGGGCGTGTGGA
TGTGGCTTCGGGTCGTGGGAGACCGCTACAAGGCGACGATGGCGCGGCTAGCGTCCATAGGAGAGGTGCTGGGAAGGTTGTTGCGATATTCGAGCGGGTT
CCGGAGTGGGTGTGCAAGGGCTGGGTTAGGCGCTCTTATGGTGTAATGGTTAGCACTCTGGACTTTGAATCCAGCGATCCGGGTTCAAATCCCGGTAGGA
GCTCGTTTTTGTGCGGCGAAGCAAGCGTGTGGTGTGTGTGAGTGGGTGATGGCTGTGTGTGGGTGGTAGGTGTTGTTTGAGAATGTGTTGGGGGATAGGC
AAGTTAGTGCTGGTCTTATGGTGTAATGGTTAGCACTCTGGACTCTGAATCCAGCGATCCGGGTTCAAATCCCGGTAGGACCTCGTTTTACACTCATCCT
GCCGGCAGCACCACGCCCCCGTTGTTGCTCCAGCGCGGACCTACTACACACCCGTCTCAGCGCGCTGTGTG