Description :
From Genome Similarity Track
Location :
Scaffold_3:1413879- 1419059
Sequence
5180 bases(100 bases per row)
CCAGACTAACAGCTCTGTGTTGCCTTTGTAGGATGCCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAATTGGTACGTCGCGACGATGTTGCCC
GGCGACTCGCCCTGGATGGTCGGCCGACCCTTTCCCGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTAAAGATCCCTGGCCAATGGA
AGTGGTGCCTCACGCGTTGGTATGTGCGGCCAATACCCTGGTGTCCGCCTTCCAAGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGAAGAGTCTCCGG
GATCACCAGCTTCATCATCACATCGCGATCCTCGGCGGAATCGTCGCTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCATCTTCGTACTGAAACGCA
AGCTTTTGGCAGTTCTTCACCTCGCGCCGAGATAGGTCTCCGACGTCGCCGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTCGTCCTGGGCGA
CGCGGATGCGGTCCAGGCGCAGTCGTTGCACCACCAGCTCCTCCAGGACTTCTGGAGGTTGGACCCTACGTGTTGTCGTGCGTGCGGCAGCCGAGCGAGT
CGTCACAGCGAGGACTTCTGCTGTCCCGCGTCCCGCGTCCATGGCCTTCCGACGGGGTCATCTGCGCCGCGTGTTTTCGCGTCGAGATTATCCGCGTCGG
GACTGGCTGGAGACTCCATCTCGGGACTCGATGCCAGTGGTCGAATGACTTCTCCCAAGCGATTCAGCGTCTTCAGATCTTGAATCTCTTCGGGGCTGTG
AGCGTTGCGGCCTCCTTCAGGCTGCAGATCTTGTCCAGCCAGCATGTCGGCATTCGCGTTCCAGTCTCGTCGTACGTGGAAGAGTTTATGGCGCAGCCAT
GCCTGGAGTGCGTTTCGCGTCTTTTGTCGCAGCGGCTTCAGCCCCGGGAACTTGCAGTCCATCTCGACCCGCATCTGCCAGAGACAAGGTTGGAGTCTCC
GCATACGCCGAGTCGGGTGACGTCGTCGAGTCCCTCTAGAAGAGAACATCCGAGCAGCAGCCCGCGGTATTCCGCCTCGTTGACCGTGAGGTCCGTCGCA
TATCCCGACGCGGCGCGCACGATCTCCCAGTTCGGCGGCTGCCAAATGACGGCACTGTATGCTCCGTCTCCTCGCTTCGCCTTGGCCGATCATCAAAGCT
CAAAACGTGCAAGACCTCGTCGCGCGCCACGTCAGGGACTGGAATGACTACAATCCTGGACGCCCGTCTCCGTGGGGCGATCTCTTCTAGCGCCGCGTCG
ACGAAGGCTCGCGGGGGTAATGCTCGCAGCCAGCGCGCCGAGGAGTTCTTCTTCTCCCTTCATGGATCGGCAGATTTCCAACTTCCACGGCGAGAGGATC
GCGGCCCACTATGGCAGTCGCCCCTGTAGTCCTTTGGACCGGAACAACCAGGCGAGTGTCGTGTGACGTGTCAAGATGCGGACTGGTCTACCTGCTAGCA
TCGTGTAGCACTCGTTTAAGACGCGCAACAAGGCCAAGATCTCCTTTTCGACGATGTCGTAGTTCAGCTCGTTGGGCTTCAACGTACGACTGGTGAACTT
CACAGGCATGTATACTTCGTCGTGGACCTGCGTGAGCACCCCTGAGATGGCCCAGTCGCTGGCGTACACGGTCACGACGGATTTTCGGTTCGCGTCGAAG
TGTTCAACATTGGGGTCTCGGCAAGTTTTGCCTTGAGCGCGTCGAAGGGGCGCGTCGCATGCGTCCACTTCTCATGCCCGCGGACTTCTGGGCGCGTGAC
GTACTCGTTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGGTTGCATACACCGCAAAGTCTGCAATGAACCGGTGGTAGTAATTGAGGCTACCCAAGAAC
GATTGCAGGCCCTTGAGCGTGCGCGGGAATTCGAGCGACGTCAGCGACTCCAGATTCTTCGGCTTCGCCTCGAGACCGAGTCCTGAGACTCGGTGGCCCA
GGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACTGATGGACAAATGCCACTGCTCGCTGACATCCAGCAAGCGTTCGACTTTCTCGCACAG
GTCGTCCCATGACGTGCCCCCGATGAGGATGTCGTCGATGTACGACCTCCGTCCCAGAATGAAGTGAATACCTGGCTTCACCGGTTCGCCGTCTTCAAAG
ACGTCCCGAGTGCTGCCATCCGGGGACAGGTTCATGAACCCGTAGAGCGCGTTGTCGATCAAGCGTTGGTAAATCTGCGGCGCGTTGCACAGGCCAAACG
GCATATGCAATCATTCGTACAGTCCCATCGGCGTGATGAAGGCTAAGATGAGCCGGGCCCGGTCTGTCATGGGGACGACCCAGAAGCCGCTCATCATGTC
GAGGGAGCAGTACCACAGATACTTGTCCAAGTCTTCGAGCAAATCGTTGACGAGCGGCATGGGGTAAATCATCAACTGTGTCAGCCCGTTGATGAGCCTG
TAGTCAATGCAAAGCCGGATATCGACGCCGTTCTTATTTATGATCACGACAATGGGCGACGCCCACGGCGACTTCGACTTCTGGATCATCCTCGCGCTCA
GCAGCCCTTTGATCAAGTCGGCGACCTTCTCTCGAAACTTCGGCGGGATTTTCCGGACGCGTTGCGCGACGGGTTTTTCTTCGCCCACGTCGATGTCGCA
GACAACACCCAGGGCGGCCGGCGGCAAGGCGTTGCCTTTGCCGATCAACCACTTCCGCCGTTGCCAGATGATTTGGCGTAGCCGCGTTTCTTGTCTCGCG
GCTTCCTCGTGCGGGAGTCCAGTCGGCATACCGACCTTCAAGTCCTCGATCTTCACCTCGGCGGTCAGCGAGAGGTCTGGCAGCACTGCCATCTCAGACT
CGAGATCCTCTACGAAGAGGTCGGACCCCTCGTGGATGAGAACCGCGTCGTCTTCCTCCTGCTCATCAGGTTTCGCCTCGTCGAAATTCGGCTCGGCGGG
GTTTGGTCCGTCGAGTTTTGGCTCGTCGAGTTCCGACTCCGGCGATTCTTCCATCGCCGCGCTTCCAGCCACAGTCGGAGGCATATCGGGTTTGCTTTCC
ACCGCATCCTCGTCCGTATCCGGCTTGTGGTCGCCGGGTGGCAAGACTACCCCCTTCCCTTCGGCGCTTCCGCGACAGCCGCCAACACTGGGGTCACGGC
GCGTCGCGTCCCGAGGTGTCTCGGCTCCGGGCGCAAGATGGCTTTAGGCGTCGGGTATGAGGGGCGATCCGTCATCGGTCCGTCGAGCTCGGCTGGGATC
CAGTTCTCCTCCGCGTCGCGCCGTACGCCAGATTCTGCCACTGCTGGTACCGGGTGGAGACCAGTCGGACGAATCCACGGTTCCGAGGCTGGCCGTCAGA
CGGCGTCCACCACCCAAGCGTTTCATGCGCGTCGAGGGTTATCGCTGCGTCTCCGATGTTCGTGACACGCAGGTACGTTTTCTTTCTGACTCTCCCCTTG
ACAAAGGTAGTCACCCACGACTCTGCCCGTTTCACCCACAGGAACGGCGCGTTTCGATCCGGCCTCAGCAACACTTCATGCGTGTCTGCTGGTTCGAGCC
TCACAGGCGTCTTGACGTTGACCGGGTGCATCCGTGCGCCGTATAGCGGTCGTCGTCCGATCATCCGGATATGCACCTCGTCGGGGAGGCACGCCGTGCC
GTCCGCAGTGTCGATGCGCACTCCAGCGGGCACCATGAAGTTCATTCCCAGGATTGCGTGTTGGCCGACCAAGTCGCCGACCCACAGGTGCATGTAGTAC
ACCAAGTTCTCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACCGTGTAATATGTCTCATCACAAATTCCCACACACTCTTGCGTGATCTCCGTGTCAA
TCAGGCAGCCTACCTCACGAGCAAATGTGGTGTCCAGGATGGACACCTCGGCACCTGTGTCGAGCAATAACACAGCACGGCGGTTGTTCAGCTTTCCATG
AATCTTGGCCTGCTTGTACCACTTGTGCGGCGCGTAATGTTTCCAGTATCAGCGTCGCTCTCCTGGTTGCAAGTCGATCTCGTCCAGGGGTGGTTCACGT
GCAAACTCGTTGTCCGTCGTACGTCGGACCGCCGAGATTCGCCGCGCGCGTTCTTGCGTGGTACGTTCCAGGTTGGATTCACATGTATTATCATTCAGGG
AAGTCGGGCTCTCACTAACCACCTCTCGTGACTTCTTGGTCACATATGCATAGACGGAAACAGGTCTCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCG
TCCTAGTTTAACATCTTCTCGGCGGCCGGCGGCAGCATTCCCGCGTGTTTATTCGAGTCAAACCACTGGCACAATTGGTTGAAGAACTCCTCCATCGGGC
ATTCTCCGGCTTCGTGCACGTCACCGCAGGCCTTGCACACCCTCAAGCATCGCTCCGTCGGGTGCTGGCCACCACACTTCTGACACGTCAACAACTTCCA
GCAGTCTCCTGACGTGAACCACAGTGGCGGCACCGCGGGCGGTCGCGTCCCGAGTCGTCGGGATCGAAGTTGCGACGCGCCGGCTCTCCCGGCGGGACTT
GTCCCGCGACGAACAACTTGGCGCGTTCTTCGTCCGCCTCGTCTTGGTCGTACTGGCGATCGTCGCTGTCGCGACTTTCGCGTCCCGAATCGTACTCGTC
CGACGCGACGTGAATCGCATCCACGGCGCGCACCGGCTGAGCCGGCGGGGTCGGCGCCTTTTGGCGGAACTTGTTCGAGCCGAAGAGAGTCTTTTTCTGG
TGGGCCAGTCCCCGTTGTCGGGCACGCAGCTTCTTCTCCAGCGGCTCGGAGTCGGCGACCTCCATCAGCGCGAGACGCGAGGCGAGTTCGGCCTCCTGCG
TGTTCAGCGTCCGGATGAAATGCTCGACGTACCCTCGGCGTATGGGATGTTGGCCCTCAAGCCCACGACGTTGAGCCGGTACAAGTAATCCAGAGGGGTC
TCGTCGGGGCGCTGAGCCGCATGATAGTAGCGGCTGGCCATTGACACGCCCTTGCCGTAGTACTGCACACGGAATTGCTCCATCAGCTCGGTCCATGATT
TCTTGACCTTCCTGGGCAACTGGAGATACCATTGGTGCGCAGTGACGCTCATTAGATCGCTGAATTGCCCGCACACTTCT