Description :
From Genome Similarity Track
Location :
Scaffold_499:14131- 16929
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_499-snap-gene-0.11Bifunctional aspartokinase/homoserine dehydrogenase

Sequence
2798 bases(100 bases per row)
ACTCGCGGGCGCCGCAACTCCGCGCGAGGCTCAAGATGCTACCAAAGAGCGTGCCGGCCGTGATGGCGGCGTCGGCGATGGGGCCCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCCACGGGGTGGCGCGCATGGCGTGCCGTGTGGAAGGCGAACCCACCTTGCAGTGGCTGCAGCGCCGCCANNNNNNNN
NNGGTCCGCGGCCAGTGCCTCGACGGCCACGCGGATCGCGCCGCTCTGCGCGTCGACGTGGGCAACCACACGAAGCGACGCGACACCGCTCGCAGCCGCG
GCGGCAATCTGAGCCTCCAGAGGTGCGCGCTTGGACACAAGAAATGCCAGCAGCTTGGCATCGTCCCATGTGCGGACGTCGCCGTCCTCCTCAGTCACCG
CCCAGCACGACTCCACGGAGACATCCTTGAGCTCGGCTGGGAACCCCAATTCGCGTGCGAGGAGTACGGCCTTCTTGGCGCTGCGCATGCCGCTCACGTC
GTCGAGAATCTCACGCACGCTCATGGTCTTGCGGTACTCGCTCACGTGCTGCTCCAGCACAGTCTCAAGCGTCACCGATGCCGGCGCGGCCTGCTGCAAG
ATCGAGTTGAGCAGGCGGCTGCCCGAAAATTGGATACGTTCGACTTGGTCGCCGGTTTGCACGAAATTCTGGAGCGTGTTGAAGAGCGGGACCCCCATGG
CTAGACACGCCTCGGTGTCAAACGTGAGCTCACGGTCCGACCGCGTGCTGCGCAGCCTGGCGTGGAGCGACGCCGCCGACGTCGCGACGTCCTGATTGCA
CGTGATCACGTGGACGTTGCGGTTGAGCCACACTGGGTAGAGATCCTCGACGTGATTCTGGCAGTTGGACACGTCGACGATGAGCCAGTGCGGCAAGTGG
TCGGCGCATACGTGGCGGAGGAACGCGTCGTGGTCAAAGGCCTGGAACTCCCTCGCGCGGTCCACGAGGCAGTTGGCCGTGATGCCGCCGTTGTGGTCAA
GCAGCATCTGCGAACTCGCGTGGGTCGCAATCGCTCGGATGCGAATGTCGACGTTGAATCTCGCCTTGAGGTACTCGCACTGCTGCGTGTACTGCGCGAG
CAGCTCTCTGCCGACACCCGTGCCACTGGTCTCGTGGGCCTCGAGATCCAAGCCGACCACGCCAATCGAAATGGTCTGATCCGACAAAAAGAAGGCCGAG
TGCACTGCCCGCAATGCCGCGGCCGAGTCTTCGTACCTGACGACCGCTGAGATGTTGCGCTCGGACGAGCCCTGCGAGATGCCCATAACGTTGATCTTGG
CGCGGCCCAAGGCACCAAAGAAGCGGCTGCACACACCAGGCGTCTGGCTCATGTTGTCGCCCACGGCCGCAATGATACTGATGGGCGCCATGAAGTCGGT
CTTCTCAATGAGGCCGTGGTGGATCTCCTTGAAAAACGTCTCGTCCACCGCCACCTTGACGTCGTCGGCGCGGCTCATGGGCACGGCAAAACAGATCGAG
TGCTCGGAGCTGGCCTGCGCAATCAGCACGACGTTGACCTTGATGCGGTCTAGCGCACTGAATAGTCGCGACGACGTGCCGTGCACGCCGACCATGCCGC
TGCCTTCAATGTTGAACAGCGCCAGGTCGTCGACGGTCGAAAAGCCGCTCACAATGTTCTTGGCCGTGGGCGCGCCATTGGACACGGACCGCCGGAGCGT
GACCCGCGTGCGGCTGTGGATCTTGGTGCCCGGGTGGCTCGGTTCAAACGTGTTGCGGATGAAGATGGGGATCGCGCCCACAATCGCCGGCGTCATGGTC
TTGGGGTGGATCACTTTCGCGCCAAAGTAGGCCAGTTCCATGGCCTCTTCGTACGAGACCTCGGGCAGGATCTTGGACTCGGGCACGCGTCTCGGGTCGG
AGCTCAGCACGCCGCTCACGTCGGTCCAGATCGTGATGCTGCTCGCGGCCAAGACGCGGCCGCAGATGGACGCCGTGAAATCGCTGCCGTCGCGCTTGAG
CGTCGTCATAACGCCGTCGCTCGTGCTGCAGATAAAGCCCGTGATGACCACGTGCGTGTGCTCCTTGCCGTCGCCATGCTCCTTCAAAATGGCCTGCAGA
TTCGCTGCCGTGCGCTCGTACTGCACAACGGGGCCGTGGTCGTCGTCCTGCTCGACCGTCAAGAAGTCGCGCGCGTCCACGAAGCGGTACTTGTGCGCGT
GGCCGTCCTGCGCTGCGCGCAGCGTGAGCACCTGGGCTAGGATCTTGGCCGACCAGATCTCGCCGTGGCCCGAGATGAACTCGACCACGCTGTCTGTGTA
CGTGCGCATGATTGAGATGGCGCGCAACAGCTCCGAGAGCCGCTGGAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCC
TGCTCGATGGGCTGGCCCACGTCCGCCGGCAGCAGCGCCGCGATAACGGCGCGGTGCTTCTCGCGAATGGTCTCGAGGATCTGCTCGCACTCCTTGTCCT
TGCGCTGCTTGGCGAGCGCGAGCAGGCTGATGAGCAGGTCGGTGACCTTGGGCTTGCCGCCGATGGCCGAGACCACGANNNNNNNNNNNNNCGCGGCGAG
TCGATGGCCGCGACGATGTCGGCGACGCGCGCAAAGCACTCGGCGTTGCCCACGGACGTGCCGCCGAACTTGTGGACGACGAACTTGTCGCTGGCGTCAG
TCATGGTGGTCGTGGCGGTGGTCCTGAGCGAGGGAGAGCGGTGGGGGTGGCGGCGCCGCCGAGGAGCTTGGGAAATGAGGAGAACTGAAGCACCTCTC