Description :
From Genome Similarity Track
Location :
Scaffold_44:141309- 146669
Transcript NameFunction/comments
Hyaar_Emoy2805946Chromosome transmission fidelity protein 8 like protein
Hyaar_Emoy2805947fatty acid--CoA ligase
Hyaar_Emoy2805948HECT E3 ubiquitin ligase putative

Sequence
5360 bases(100 bases per row)
TGTCCCAAGCCAAGTATCTCAAGACGAGGTGTCCGACATCGCATGCCCCATGTCAAGTGTCTCGAGTCAAGTGTCTCGAGTCAAGTGTCCCGAGTCAAGT
GTCCCATGTCAAGTGTCTTCCATCCATTCGCTACGCGAGCACAGGCTTTGGTCGGGATGCGAACACGACGCGCGTGCGAGCAATCCCCACGACTTCGTAC
TGAATCCGTGCACCTGCTGCTTCGTCCCTGCCGTCGGTCATCCCGTTCCTAACGTTCTTCATCTCATCTTTCCGCATAATCGCAAGCGGTTTTGGCAGGG
TTTGCACTCTCCCAGTCAACACGTGCGTCCCAATACGCAGTGTCAGCGCACCACTCTGTCCGAACCGAAGTGTCCCAATATCCACATCCCGCAGATCCAG
CGCACCCGCACCACCACAGCGAATCAAGTCCCCCTGAAACTCCAGCAGACACCACTCCTTCGCTGCTTCGTCCACCATCACCGGCACCAGCATCACAGCT
CCCGCTTCCTTCTAAATCCCGCTCGGACTCGCACGGTGTCCACTCACAAACTGTCCCGTCAACGTATATAATGTGCACTACACCACCCACATCCCACCTA
CTTTTCATTTCTATCATCCGTCTCGTTTCTAATGTGCACTACACCACCCACATCCCACCTACTTTTCATTTTCTATTATCCGTCTTATTTCTAATGTGCA
CCACACCACAACCCACGACCCACCTCCCTCCTACACGCCGCTCATTTAACCCCATCACCTCCTCCATCCCATCATCATGTTCGCCCGTCTCCCCCTCTCC
CAGCGCGCCCTCGCCCGTCGCAGTGTCAGTACCATTGGCGCTTCTCTCGACCAAGCCGTGGCCCGTCTGCCGCACAAAGAAGCGCTCCGAGGCGTCACGC
AGGACGTGCGCTGGAGCTTCCAGGAGCTCCGCGCCAAGGTGGACGAGCTGGCCAATGGGTTTTTGGACCTCAAGTTCCAAGTGGGCGACGTGGTGGCGCT
CTGGCTGCCGAATAGCGTCGAGAACGTCGTGACGCAACTGGCGGCGGCGCGTGCAGGACTCACGCTAGCGGTGATTGCGCCCGAAGTGGCAGAGATGGAG
GAGCTCGCGTTCATTCTGCAGGACAGTGGAGCCAGTGGCCTCGTGTTTGAACCCAAGCAGGCGGGGCGGAATCAGACGCACATTGTGCAGACGCTGTTTC
CAGAACTGAGTACCTGTAAGATGTGATGTGATGTTTGAGGTTTTTTGGGGAATGGGTTTATAGAGGATGTTGTTGATGATGATGTTATTTTTTTGGGGGT
TTGTGTGTTTTTTTCTTTGTTTTTTGGTGCAGTTCGGGAACGAAAGGAAGTGTTTCGTCCGAAGCAGTTTCGTCATTTGCACAGTGTGATTACGACGAGT
TGGGACCATGTGGAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCATCCTTGTGATATACTATAGAACATAAATAACATCTTCGCCCCCAACA
TTTTGGGGTTTGGTTGGTGGTGTTGAAGTTGAAGTTGACGTTGGTTTTCGTCTGGTGATGACTTGGATGTGCTGTTTTGTGTGGACACAGAGGTCGAGGG
GCGGAATCCCAAGAAGAGCGCGGTGCTTACTCACGGAGATCTATTGAAGCGCGCAGAGGCGTTGGCCCAGAGGTTGGTGTTGGCTGTAACTTTTCGGACT
GGCACATACACTGTCTTGGCACTGCTTCGTGCTGATTGTGTGCTTGTCTATTGTGGTCTCTTTTTTGCATGTGTAGCTTAAAGTTAACTGCCACGGACAA
CCTTCTGCTCACTGGAGAAGAGACGGGTCTGTCACTTGGCCCATATGCTGCTATCGGAAAGAGCTCGCAGATCGTGCTGCCGTCCACGGAGTACAGCAAG
GAAGCCACGCTGCAGGCGATGAAGGTGGAGCACTGCAGCGTTGTCGGCAGCGGACTTGACAACTTTAAGCGCGTGTGAATTGATGATGCTACGCAGCGGT
CATGTCGTGACCTTCACATGTCTATTGAACAGATAGAGAAGGACAAACAGGAAGCAAAAGTGAGTGAGTGAAGAAAGCGTTGTTCTTGTTCGTGATTCGA
CTGCTTTGTCAATGTCATGTTGTGAGATGGATGATCCGGCAGGTGTTGACGACAGGCAGCTTTTGTCGAAACTGGAGAGAACAAATCGTTTGTTTGCTAC
TGCTTTTAGGCTATCAGGATACCTCCAAGACCAAAAGTGATAGTAGCAAGCAGCATGGAGTGCATCATCTCACGCGATATATACGGCGGGAGCTCGACCG
AAAAGAAACAAGTGTGCGCAACTGGTAGGCTACGTATGGCGTCACGACCACCTTTCTTGGACAATTTGAAGGGCTGGAGCCACTTGCCACGAGGTAGCCG
ACTCCGGCCCCATGCAAAGCGCACAAAATCTGCGCGTTGCGCGTCTGTGAACTCCGCAAGTATCTCCCAAAAGAGCAGCACGGTAGGGTCATCCTCGGAG
TAGCCGTCGTAAAGCGTGTGTCTCTGCCAGAGATCTAGGTCGATTTTGGGCGAGCCACACGCAAGTATTTCAAGCTCCTGCCACGTTAGAAGTGTCAGAA
CGCGACGAGGGAAAAGCGTTGCAAAGCCTCGGGCCATGGCAGCCACCTGTGCACTGCCTTCGTCTAGACGGGCGAGTTCTGCAAGGCGACAATACTCCAA
TCGGTTGTGGAATTCCACTTTAATGTGGCGACCTCCAGGCACAAGCTCCATCTCTTCTCCCGTGCACGACGAGGCCGTGAAACGCAGCTCGAGACCATCG
AAGGCCGTGGCGAATTCTTGCTCCGTAGAGATGCCATCTTTCTCACAGTTTGCAATGCCGTCTAGCATCTGGACAAACATAGCATCGGTTGCTTCAAGAT
CAGCACGTGTAGGTGGTTGGCCCAGTACTTGCTTCCACACCAGTGATGGTAGCATGAACGGAAAGTCACCGTGCGTGCGCAGCGAGATTCCTAAGAGCTG
GCCGACAAATGCAAACATTTGTATCGCAACCGGAGACGTGCACTTGGGGTTGGGTAGATACATGCCTCGATTGTCGCCAGTGTCGTGCTGGCCATTGGGG
CACAAGACGAATAAATGAAAGTGTGGTGAGAACAGGTCGTCCACCATGGATGTGGCGCCCTCGCGATACACGCCACCCCAGTCCACACCTTCCTCTCCGC
GGAATTTGACGCTGAACAGGCGGCCCTTGCTGTCAATTTGTCGTCTTAGTAATGTTGGATCTACCTGATGCAGTTGACGAAATGCCTGTGCGAAGAAGCA
TTCAGATACAGACGGCTCCACTTCGCAGTCATCACGCGATTCAAGCGCTTGGATCCTGTCTAGTGTGATACGCGCCGTTTGCTGCTGTGCGTTTCCACCA
GAGGTATCCCGTGGCATATTTGTCGCTTCGATTGCAGCTTCCACCAGCGCATTTTTCACGTCAAAGAAGATGCAGTGGCTAAGCTGACGCAATCGATAAG
CCACCGTCCACGGGGATGTCGTGTCACGCAAATCAATAAATGGCAGGCAGTGTTGCAGACTCGAGTTCAGATACTTCAACAACGCGAATCGACATTGCAG
TGTCTCCAGTGGCAGATCCAGCAACTTCGAGCACCGCACCCTATCATGCGTGTGGCTAAGCTGTATGTCCACTGGTTGCAGATCGACAGAGCGCCTAGTC
GTCGTGGGGCTAGACGATGGCAGGGACGCTCGAGGTTCCACGTACTTGTTCACCCAATCCACCAACTGTGAGTCCGTTGCTTCAGTCCAACAGGCCTCAT
TTGGTAAGTCACCCGAACCTGTTTGCAGCAGAACAAGTTTCTGCAGCACGTGTTCCATGTCTTCGACAGTCGCGCGAGAGAGCTGCGTCTCCTTGGGAAC
GCCCAATGCAGTTACAGTCACAGCAAATCCAAAGTGGTCTTCTTCATTTTCGTCCGCATGAAAGGTGTACTCAAGATTGTTTCCGTCATAACATGTGGCC
TCCTCATGCCACGAGGTCTCACCCGCGTACACTCGCTTGCGACGAACTTCTTTGACTGCGTCACCGTCACGTGAAGTAACCACAAAGCTGGCTAGATCAA
GTCGTGGCATTTTATTTTGACCTTGGCCAGGCGTGAGTGAACAGCGTGAATCGAATGTCATTCGAAGAGCTTGAGCACCTTCAAACGCTAGTACGCCATC
CAACAGGCGACCAGGGGCGTAAGGATGAGAAGTTTCGATCACTGCGGATGACCCGTAGACCTCCAGCCATATTGCAACCAGCACATGTTCAGGAAGATTC
TCAATTTGTCCAAGCAAAAACTTTGTGAGCACCGAAACGTCGTTCAAACTGTCAGCCACACACTTCCGCTCGAACGGCACTGGCATATTAAAAGGTGTAC
TGAAAAGTGGCGTTGATGTTGCATTGGTGCCGGCAAGCTTGCGCTTGAAGGCCAACGAAGCGGACGAGGTCATCATCGACAATTCCACAATTTGGAGCAA
GTGTGCTGAGATAAACACCTTTCCTCTTGCTCTGTCAACTCCAGCACAAGTCAATGCCAGTCGACAAATCGATACCAGTGCATCCAAATCAGGCATTTCA
TCAGCTGGAAACAGCCCAGGGTGGTGCAACAGCTGTTGCAGTAAGCGTACAATACGACCTTTGTGCGGAGCTCCTGGTGAACGCAGGTAGCGTACAAGTG
CGCCATAAATCTTACAGTTATGTACACCTCCATGGGCTATCAACTCTGTTGCGTCATTCAGCAAAAGTTCCAATACCCAGCACGCCCACTCCAGCGACGG
GCTTATCAGCACCTCAGACTCTTTCGTCCAGCGATTGTTAGCCATTGGGATTACTTGGAA