Description :
From Genome Similarity Track
Location :
Scaffold_1015:1413- 3105
Transcript NameFunction/comments
Phyke_g11420hypothetical protein PHYSODRAFT_333615

Sequence
1692 bases(100 bases per row)
atatTTGTCGGGATCCGGTCTGAAAGATGGATATGCTAATTCAAATATCAAAACAACAGCATATTGTTGGCAGATTTGTGCTGTTCCGAAAGTGAGGCAA
AGCCCTAGTAAAGAGACCTCGCTTGCTTGGATTAAAATCAATGGTAGGAATACACTTGCATTGTTAAAAAAGCAGACGAGTCGGTCATGAACTTAGTGTC
GTTTGTCCCCATGAACACCAAAAAAGCGCGTACCACCGCGATCAGCGCTTTCAAGTGCATGCTTGAAGTGGAGAGGGTAAGTCTTGAGCATGTCCAAGTT
GGTATTCTAGTTGATCGCTCTGGGAAGCGCTTGGCTGCTACGATGGATCACTTCAGGTTCTATCTAGCAACTCATGAAGGTAAAAGAGGTAAGCTGGCAC
GAAACAGTGCTACTTCATGCTATAGAGATGTTAGActtcgtttttttttactcGTACCCTCATCTCCATGTGCCCACCGAGTTGCTTCTCTTGAAGCAAG
GTAAAGCGCTATACAAACATTGCTTAAAGAGAGAGAAAGGAGGTTTTATTAACAAGACACCTCCGTGCACAAAGGAGGCTTTACATGCGTTAACCGAGTA
TGTCTACAGAGATGCTTTCATTAGCACTGActaccaagaagctgcactgGGCCGTTTGTTGTGGCACTCTTTGGACGCTCGTCCGATCTGGGGTACATCC
AGAAACAAGACATGTCAGTGTCAGCTGACAGTATCTTTTACATGCGTCTACTGCACGTGAAGACCATTGAGGAGCAGGGATTAATGCTCGTCTTAGACAA
GAACGACTTTCTTACCAGCCCACTGCACACACTGTCCGTCGCTCTCGTGATGCAGGAGACGTCATGTGGATCACTCCTCAACTTGATCCCCGAACTACTG
CCGCAAGAAGCCGTCGAATTTGACCCGGGTCTGCCGCTATTTAACCTGTTGGAGACCGATCTCGCCGAACTAAACGTAGCCTTGATATCACCGTGTCCTT
CCGATTCTGGCACTGCTGTAACCCCACTATCTATTCCGACACAAAGTCTAACCTCGATGGCGTTCACCCAGACTTCGTCTTAATCTACGGATGCAGCTCG
AGGCCAAAACGGAGTCCAGGCGTGCGTGAATTGGCTGTTGAAGCACATAGATGACCCTGCTGGCACCAATGGGTATTTGACGTCGCATCCCTTTCGGCGC
GGAGGTAGATTGGCAGTAGATCTTCGACCGCGGAGCCTGGGATATGAGCAAAATAAAACAAGAAAATCGTGTACATGTTCAACATGCCTCGAAAGGATCC
GAAGGTGGCACGGGTGCTGATTGGTTGGGCGGTTGACGTCGAACAAGCGGTTGCTAATGTGGCGGTACTAATTCACCCTACACTGGAGCGGCTAGGACGC
TTGCAACAACTCCTGTTTGGCTCCTGCACAGGTCTGAAGGAACAACGACTCAATGTAGGTAGCAAGATTCTCAACGTACTCACCACACACCTTGTCCATT
ATTACCCGCATCTGAAGGCGCTTGCACCGAATGCCCTGATAGTCAAGTGCATGGAGGAGTGCTTAGTCGCTGCAAATATCCCGATTGTCGCCTTGCTTGC
ATGGTCTGTGATGTTAAACACCGAGGCGGCTACACTtgttcaagaacaagatcaaaaggaagagaagacacaAGGATGTCAAAGTTGTCACC