Description :
From Genome Similarity Track
Location :
Scaffold_70:141292- 148616
Transcript NameFunction/comments
Phyci_522264Hypothetical protein

Sequence
7324 bases(100 bases per row)
GTTATGCTGGTCATTCCACGAAATCCTCAGCGACCTTTGACACAACACTCGGACTCGTCGCCTACGAACCACAGCGGGGCAGCCAATTCCTGCTGCGGCG
CACGATGCCTGTGCTCCTGCTCCTGCATCTGCTCGCTTGTTGCGGCGTGTCTGCGCAGACCGGCGGCAGCCCCACGCAGACCTTGTCGCGAGCAGGCTGC
GCCTGCCAGCCCACGCTCCTGTCGGCGACGAGCTCGTCCGTGACCTGCTACCAGGCGAACGCCAGCGCCCCCTTCGGCTGTGCAGTGGATCCTTCCGACC
CCTGCTCGGACGGCGTTCTTGGCCGAACGTGGGATCTTTGTAATTGTAAGTGCAAACGCGTCACCCATGCCTCTCCGATCAATACTAACGCATGACGTTA
GTCGTCGACTTGTACCTCGTCGCGGACCAAGTGGCGTCTTCCACCTCGAGTTCCTCGCTCAACGCCACGCTATATGGCAAACAACAAGTGGTGCTGAAGA
AAACGCAACTGTCGGGCGTGATCTTCCAGCGCACGGTCACGAAATTCACCCTCGCACTGGATAATGCAACTCAAGTCGAATCGGTCAAGGTAAGAAATCG
CTTCACGTTTTGTTGGTGATTTACATGGCAGTGATGTTATGGTGTTTTACTTGCAGATCGAGGCGCTGGTGAGCACATCACTCCGAATATTTGAAGTGCA
GGCCACGTTAAACGATTTACCTACCACAGTATTTGCTCCTCCGTCGCCCGGACCGATTTCCTTTGTGAGCAGTGATGACACAGCAGCTACCGGGGTAGTT
TCGCTATTGTTCGTGCCCATGACGGAATACTTCGACGGTCCGTGCCACACAGCCACAAGGCGATGGAAGTGCAGCACCACTCTGACTAACTTTGTGTCTA
TCTCTGCATGGTTAGGTGACGCTCTTGGACAATGCTACTTTGACCTGGTCGGTCGCTGCGGGTATCACGCTGATCTTCAGAACAGTTCGGATTTGCTTTT
TCTAGCCGAGGATGTCAATGAGCCAGTTGTGGCAGCAAAATCGGCTACACCGCAGTCGTTTCGGCGCTTGTCCGAGCAGGAGAAACCTCGGGGGCCAACG
CTACGTTCTCTCTCCTTTGTACCGAAGGTTAACGATCGACGGTCGGCAGGTAGGTCCCAGCCACCCCGCGCATACGAAAACGATGAATTACGAAGTGAGA
CTATCGTGGCTGGTGCGGCTATGCAGCCTGCTGCTATTCGAGTGGCCGACATTCTCGGAGAAATTAGGCGTGAGCGACTGGGAGCTGGGCGTTTGGATTT
GATGTCTTTGGAAACTCAATGGAACACTACAAGTGCGATCATGAACGCACGGATTGGTGGTCTCGCAGCGAAAATAACCGTGGTGAATGGAAGAGTTGTA
ACTCGCTGGCGCTTAGTGCGTCAAAGCTCAGTCGTGATGATCTACCGAAAGGCAAGCTTCGCCAGCGACAATAACTTCAACGTTGTGGTTCAGGTCCGAG
TAGCAAGGAAAGTAACCCAGTACTCAAAGTCGTTTTTAGTGGACGTGGGTTCACGGGTAGCTACAGAACCCACTGTGGAAATGCAAGTAATTGATGAACC
AGTCGGTCGATTCCCAGTTAAAAGCAGCGAAGACGGTGTCTTGGGGGTTGAACGTCGATTGAACACGGGAAGCACCGGTGTTGTTACCTTGGAGTCACTT
CCCTTGATTGTCGACCTAGAAGAGGGCGCCTCGTTACAGCTTTTGATGTCAGAATTCCTTTCAAGTGGTACATCTGTAAGCTCTGCAACTTGCAAGACAA
CTTTCGCGGTTTTCTCTCTGGAGAGTGTGGTCGACTCGGTGAAAACTCCATCAGTGGGAGTCTTGGACGTATCCGGCACTCACGACCCCGTGATCGTCCA
TTCATGCAGTGAGACCCTGATGATTTGGCTCAAGCCCGATGTCAAAAGCATTCAGACTCAGTTAGACGTTGAGATAGTAAACGCGCAGGATGTTGTGCTT
GAACTTGCCAGTATACCTCTCATCTGGAATGTGATCCCCAGTGTCAAGTTGCCTGTCGCGAGTCGGCTTCTTGTGGGAGCACGTAATACCCTCGCTGGTA
ATGCGTCGACTCTGGAGTTGACGCTGAATTACTCGGACGTCCCACCTTCTGCCCGTGTGGACATCACTATCGATAACTGCTCCTTCTTAAGCATTCAAAC
AACTGGGAGTGCTAACGCGACTAGCGAGGAGTGCACATTTCTCTTGAAGCCCTTGAATGAAAGTAGCAATGAAGTCGCGCCAAGTGGCATAAGGATTCGC
CAAGTACAAGATGTCGCCAGTCGAGTTCTCATTGAAGTTACGACATCCAAGTTTGAGCAAGGTGATGATGGCATAACTTGGATGCTCAGTTCATCCAACA
TACTGTCGGATATTCTCCACTTTTGCGAGTTATCGAGTCTCGATACTGGAGCTCAAATCCTGCGAAAGGGAGAGACGAAAAAGTTCCGATTTACCGACTT
TGTCCAGGCAGTTCTTGGCAACGATCTACCAAGCACTCAGGCCACGACGAATATTATTTTTGTTGGAGGTCCCGACTTCTTCGCAAGCGTTGGTAACTTT
CAAGTTGGCGAAGAAATAATTCACTTGGATACCTACAATTTGACTGCTTCTTTCGTCACGTTAAGTGCCGACAACTCCAATTATTTTACCCTCACGGCAT
TTCAGTACGGGTCTTTCTTGGTTGATTTGATGTTGGAGTGGAAAGATACCACCACTTCGGATTCAGGGTGCGTTTTTGTGAGGAATAAGCTGGTGTCAAT
TCTCCCAACCTTTTCCCTGCCACTCTTTGCTCCTCCTTACTCGTTCAGCCGAAGGGTTCTTCAAGGCGGTTCCACTCAAATTACAATTCCGCTAATGCAA
GTGACAACCCCAGAGATCGAGAGCCTGACTCTTGGACTAGCGGTGAACTCGACGGACAACAATATCGTCGTTAAGCGTGGCGACACCCAGTACTATTCTT
CTTCAATTGACCCGCACTACTATTTCCTAGTCGAACGCGACATTAATCTGGACTCTGCGAGGCAAGTTGTTGTCTCTGTTACGCCCAATGATAGCTTTGT
CGGAACTCTGCGCCTCGATATCGGGGTTGCTGCGGTAAATCTTGTAAGCAGTGTGGTCGCTTTTGCTGAACTAGACGTCGAACTATCCATAATCTGTCAG
GTCGAGGTTGAGTGGATTCCGAGAGCTAAAGTGGACGAACCGACCACTTCAAGTGAAGCTGTCTATCGAAGCCTATCGACAGAGTTGCAGGGGAACTCGA
TGCTATCATTTAAGTACCAGATGGGGTCAGGTAAGAACGTAGCGGGTATTTTTTATTCTCTTTCAACTACTTCGACGTAAAAATACTAACCAATCCCTCG
ATATCGCCAGATTTCTCGAGTATTAGCACGGATGTGCTCTTGAATTCAAGTGAAGCAAGATCAGTGTGGTCTAGCAATTCCGCTGTAATAACCCAAGACC
AATGGACTTATGTCGAGGCGTTGATTGAGCTCTCCTATCCATCCACTGTTGAGATTATTTTCCGTGGCATTGCAACAGTGGAAGACACGTTACAGCTAAA
AGAGATCGCAGTTCGCGACTTCGCTCTAGAAGGCATGGTAGGATCGATTGAATTCGTTCAGGCTACAGGTGGCATGATTTATATCCAAGTTAATACGGCG
CAATCTATACCGGATCCGGTGCTGATTCGTGCTTATGCCAGACGCTTAGATACCAATGTGTCCCCAGCTCTCAGCTTTACTGGTAAAGGTTCTTTTACGA
CTATTCTGCGGTGGTTCCCAGACTTCTGGCTAACATTTTTGCGTATTTTTGTAGGCGATGACCTTCAGTTTATTGGATGCGAAGCCACCACCACGATGTA
TCCGTGCGCTGACGACTCAGTAATTAATATTGACAGCCCGACCCAGTGCAGAAAGTTGTGCTCGGCTGTCGAAACCCAGCTGCGGTTTACTACCGAGTCA
ATAGTGCGAAGTTCACAAATGATATCGTTTCCCGTCGTCGATTCATTTACGATCGAGTTCTGGGTCTTTCTCGAGGGGTTCAGCACGAGTTCCAACAGCG
AGCAGCTCTTACTGCTATATGGTACTCTGGAAGGAAGTTTGAGCATTACCTTGAGCAATTCTATCACGATATCGCGTTGTTCAAACCAGCTTCGAGTTCC
TCATGGAATTCCTCTCCGAAAGTGGACCCATATTGCAATTGTCTTTAGCGCAGACACCAAAATTGAATTGGTAATGGACGGAAATCTAGTCGCCGACGGG
TTACTGAGCAACAATAATTGCAATGTGCCGAGCATTGCCTATCTTCAACTCGGACGAGGTGCGGAAATTGCCATCAATGGTTCATATGCTATTGCTAAAA
AGATGCTATGGTGATGTATATGTGATAGACACTATCGGTATTCTCCCGGATACATCCGTTCTACTAGGCGCCATGGACGAGGTACAACCCCCACACTGCT
ATACTTCAGTTTGAAAGTGTTATTGTGATTCATCCTTTTGTGTTGGCTTTCGTTATGCCAGATTCGTATTTGGAAAGTTGCGCGTGCGCCAGCAGATATT
CTCGCTTCGTTCCAGAAAAATATTGTCGACCCAGACTTGATTCTTCTGTTGCCGTTTAACTCTGCCGAGAACACAAACTGGTTCCCATCGGGGGTGGACA
TCAGCGGTAACAGCATTGATTTCATTGTCCAAGGGATAAATGTTATTAGCACTCGTACAATTCATGCTTTTTGTGTTGCTGGAGAAGGAAACTGTTACTA
CAAGCTGGTCGCGGATTCTACTGATCAGTTATCATCTTCGACGTGCGAAAAGACCTGTGGGGATGGAAGTTTGAACACATGCGGATCCAACACCAGTGCT
ACTGCGGCAAGTGTTTACGCTGAAGGCTCCGTCGGGGTTGGTGGTCTTTCGCCGCTTACAGATTACGAAATATCGGTGGAGTTTGTCACGGCTGATAATA
GTGAATATGAAATTACCAAGTCACTCATTGCAACCACCTCGAACGCAACGGTGCCCGGCAAAGTGGAGAAAATCTTTGTTATAGAACAGGATAATGACTT
GGTTGAAATTCAGTGGAGTCCCGTTGACGATGACGGAGGACTAGAGGTTGAAAGCTACCTGGTCTTTCTGAACGGAGTGCAGGCTGTTGATACTGGAACA
GGAAAGGTACTGTCAACAAGGCTACTTATTTCTGAGACGCATGACACAAACGAGGTATCGATACAGGCGATCAATGCTATTGGGATAGGCCCGATAAGCA
ATTCACTTTCCTTAACAAACATCTACAGTAATCCAGCCCCCGACGTACCACAAAGTCCTAATATATTATCTGTGACAGGGGGAACGGTGACACTCGCCCT
GGATCCGACGACACGCCTGGCGATTGAAACTCTTGCTTCTGTAGTGGTGATTCAGCAACGAATGCTTACTGTCTCAACGTTCTCGGAGTCATTTTATCGA
CTTAACGGCTCGTCCGTAGTTCTTTACAAATTACGTCACAACACAGTCTACATCTTTCGACTAAGTGTTGTCAGCAAAAGTGGAATTCAAAGTGCTTTCA
GCGTCCCGATTTCTACAAGAACCAGCGACAGGGGAAGCCCAAGTAAGACACCACAGCCTGTGGTAGCTAGTGTCACAGGTACGTGTGAATTCGTCGAATT
TATTGTACTCTACGTGTGTTCACTTTCGATGCGGTTCGTTTAGGTGGGTCTATCACGCTAGTACTCAACGAGCCACTCGATACAGGTAAGACATACGATC
TCAGCCTCGATGTTCAGCCATATCTAATGTGACGGATATGTGTGATGCCTCCTGTTGTATAAAGGCGGCCTACCGATTGCGCAGTTCAATATATTTGTCC
TCCAAGATACCGCGTATCTGAAATGGACGAGTATTGCAGCTTCAAACACCAGCGAAAACACAACGACCGACTTGGTGCGTGACGCACAGGGAATCCCACT
GCTTCCTGAAACTTCGTACACGTTCAAGGTGTTGGCACTACAAGTAGATGTATCATGTGATACGCTGACAGAGGATGTATTGGATAGTGATGCGGTGACT
GTAATGACGGAAGCTGCGGCTGTTCCAGCCCCACCTTCGTGTCCAACATTGCTACAATTGTCAGGGTGCCTTGCTTCAGTAACAGCTGCACCCCCTGACG
ATTTTGGTGGTGCTGTAGTCACTGGGATGACCTTCGAAATGCTCTTATCAAGTGGGGTTCTGCACGAAACCTTCACAGTGGCATTAGACCCCGGCATGAT
TACCACTCAGAATCTCTTAGCTTATACGAGTTATATCGTGAGAGCTTCCCTAAACACCACGATTGGTAGTTCCGCTTTTGGTGCAGCTCTGACGTTTACA
ACAGAGGCGCCAGGATCACCAGGTCAACTTGCTCAGCTTAATATCGCTGACGTTGGTCCCAGTTCTGTTCAAATCCTGTGGCAAGCGCCTGAAAATACTG
GGGGAGGTGCCATTTCAGGTAACCTTTTTCTATGCGTTTACTGTGTTAATCTGTCTGAAATCTTGCTCTGTAACCTTTTGATCTTATGTCTTTAGGTTAT
TTACTGTATCTGCGCGCTATCAACGCCAGTATAACTCGGGAACTCGCGTACAATGGCTCAGCCGATTCTACAACGACTTCATTTCGCGCTGGAGGACTAC
TTGCCAGCACTCAGTACATCTTTTCCGTCGTTCCGGTCAATCAGTATGGTATTTCCGGGGTGAACGATGAAAATGTTGTAGTCGCCACTACATCTGCGGC
TGAGGCACCGTCCGCCCCCACCAATCTTACGCAGATTCAAGTGGGTGGTGACTATTACGATTTGTCATTTTCAGAGCCAACCGAAACAGGAGGGTTTCCA
CTGAAGACACTGCAGTACACCGCAAACCTCGAACCTTTGGCGTCATGTTTCAGCGATCCGTCCGATTGTTCAACGTGCTCTCACGCGATTAACTCTGATG
GTACCATCCAAACGCTTGGTACGAGTTTGAATCTGTGCTCGACAGGAGCTTGTGATACAACTCAGAGTTGTTGCACTAGTAACGGAACGAGATGTGGTAT
TTTAGCAACGGAAACAAGGCAATGTGTTCTTCCTACCCCTGGATCCTGTCGTGTTGATAATTTAACGGTGGCTACAACGTACGTTGTGACTCTGATCGCA
GTGAATGACGAGGGGGGTAGTCCGTATTCAAACAATATCGTGGTCACTACCAGAGATTTTATTCTACCAGGACCTCCACAGGTCAATTTAGAATCTGCAT
CAGGAGGGTGCATGGCATTGGGTT