Description :
From Genome Similarity Track
Location :
contig_18:141257- 142344
Transcript NameFunction/comments
g4594.t1hypothetical protein

Sequence
1087 bases(100 bases per row)
GGCGGAGAAGGGCGAGAACCTGTCGGTGGGTCAGCGGCAGTTGCTGTGTATCGCCCGTGCGCTGATCCGAGATAGTAAGGTGATTGTGATGGATGAGGCG
ACGGCGAATGTGGACCAGGAGTCGGACAAGCTGATCCAGCAGACGATGAAGGAGAGTTTTGGTGGTGGTGCGAGCACGGTGCTGTGCATTGCTCACCGCA
TTGAGACGATCATGGACAGCGACAAGATTTTGGTGTTGGATGCTGGCGAGGTGGTGGAGTACGATACCCCTTCGGCCTTGTTGCACGTGAAGGGAGGAGT
GTTTCAGTCATTGGTGGAGTCTAGCAAAGCTGTAGGAAGGGTAGACTAATTGCACAGACATGGAGCCTAGTCCAGAGCTCACTGCTGTCAAAATGGTGCA
TGTTTCAGGGTCGTATTCAATCGGTCCGAACGTTTACGCGTACACTCATCATGGCTCACCTTGAGCCGGGGGCCGTCAATGCAGAGGTCTTTTGGAGGTC
ACTTCAGTCTTGAATTTACCGGCTGAAACTCAGGGCCTGCGTGACGTGAGTAGTGGTCATGCTGCCAGACGTCAAACCAGGCGAGCAGGATACTGCTACC
AGCGCCAATTACCATGAGGTCAAGACGCCTCGAGCCTCCTCGGCCTTGCCCTTCCCGGACGAGAGCAGACGGAATCCTTTGGACACTGCCAACCTGCTGT
CCATCGCGACGATCTGGTGGCTCCAGCCAATGCTGATTCGCGGCTACAAGTCCTCTCTAGACGAAGACAGAGTCTGGGACCTCCCGGAGGTGGACAAGGC
CCGCCCACTGCAGCAACGATTTGATGCCGCGTACGTGGGTGAAGCCAAGAAGAACAGTGCCAAGGCTGAGAAGAAGGGAGCCGCTGCAAAGCGCCCAAAC
GTCAACTTTGCCTTGTGGCAGGCCACCAAGGACACATACGTGACGGCACTTGGGTGCTACCTGGTGAACTCCGTGCTGGTGCTCATCCAGCCCTTCCTGA
TCAAGGCCATCTTGCAGAATATGGAGGGGCAGGACAACATGTTCGGCATCTCTTCCGGCTACGGCCTGGCCGTGCTGTTGGGGTGCG