Description :
From Genome Similarity Track
Location :
contig_18:141255- 142342
Transcript NameFunction/comments
g4384.t1hypothetical protein

Sequence
1087 bases(100 bases per row)
TTGTCGGCCACCGTGTCGACATGGGGGAGAGGTCTGGACTACGAAGTGGCGGAGAAGGGCGAGAACCTGTCGGTGGGTCAGCGGCAGTTGCTGTGTATCG
CCCGTGCGCTGATCCGAGATAGTAAGGTGATTGTGATGGATGAGGCGACGGCGAATGTGGACCAGGAGTCGGACAAGCTGATCCAGCAGACGATGAAGGA
GAGTTTTGGTGGTGGTGCGAGCACGGTGCTGTGCATTGCTCACCGCATTGAGACGATCATGGACAGCGACAAGATTTTGGTGTTGGATGCTGGCGAGGTG
GTGGAGTACGATACCCCTTCGGCCTTGTTGCACGTGAAGGGAGGAGTGTTTCAGTCATTGGTGGAGTCTAGCAAAGCTGTAGGAAGGGTAGACTAATTGC
ACAGACATGGAGCCTAGTCCAGAGCTCACTGCTGTCAAAATGGTGCATGTTTCAGGGTCGTATTCAATCGGTCCGAACGTTTACGCGTACACTCATCATG
GCTCACCTTGAGCCGGGGGCCGTCAATGCAGAGGTCTTTTGGAGGTCACTTCAGTCTTGAATTTACCGGCTGAAACTCAGGGCCTGCGTGACGTGAGTAG
TGGTCATGCTGCCAGACGTCAAACCAGGCGAGCAGGATACTGCTACCAGCGCCAATTACCATGAGGTCAAGACGCCTCGAGCCTCCTCGGCCTTGCCCTT
CCCGGACGAGAGCAGACGGAATCCTTTGGACACTGCCAACCTGCTGTCCATCGCGACGATCTGGTGGCTCCAGCCAATGCTGATTCGCGGCTACAAGTCC
TCTCTAGACGAAGACAGAGTCTGGGACCTCCCGGAGGTGGACAAGGCCCGCCCACTGCAGCAACGATTTGATGCCGCGTACGTGGGTGAAGCCAAGAAGA
ACAGTGCCAAGGCTGAGAAGAAGGGAGCCGCTGCAAAGCGCCCAAACGTCAACTTTGCCTTGTGGCAGGCCACCAAGGACACATACGTGACGGCACTTGG
GTGCTACCTGGTGAACTCCGTGCTGGTGCTCATCCAGCCCTTCCTGATCAAGGCCATCTTGCAGAATATGGAGGGGCAGGACAACAT