Description :
From Genome Similarity Track
Location :
scaffold_31:14124- 18484
Transcript NameFunction/comments
Plaha_PHALS_04041myosin-like protein

Sequence
4360 bases(100 bases per row)
TTGATATGTTTATCATGAATTGATTTTCCTAGCTTGCTGAAAACGCTAAAGGTTTCTTTCACAAAGACGCAGTAACGCGACATCACCGTAAGTGAGCTCA
TCCCTAGCGTCCGCTATCTACTTATGGCGCGGGACCCGATTTCTGGCGCGCCAGCTTCTGTGCCTTGAGTGAGGCCAGTGTGGGGCGCTCGAATTGCGAT
TTGCCAAGCTTGCGATTCACGTAGTACACACGGCCTGTGGAACGAGAAACTTTTGCCTCCCAGCCGACAGGCAATGACACCTCAGGCAACGCATCCAGAT
TAAATGACTCGCGGACAGGGCGATCCGCCGGCTTTACGACCGGcttgaccttagcgctcTTTGAAGAAACGACGTTTGTCGACGAATTACTATCGGAAGA
GTTTGCGGCCTCCTCAGGTTTGCTGTTTGTTCGCTTGTTTCGACTGTCGTACATTCCCTTCACTACCGACATACGGCCTTTCAGACTCGACATAGCTCCA
GTCACCCCAACTTCCATGCTTTTTACGATCGTGTTGCGCGTAGTATAGCTGTTAGTTGGACTATCTTCACCTTCGACCTCAGAAACGTCTAGGCCATCAC
CGTTGTCCCCTTTTTTATTTGAGTTCCAGAAACGGCTTCCCACACTCATGCTCGGCATACGCGGGAAGTGGCGCTCCGACGGACGCGTTTCTGATGAATG
ACGGTTAAGGTCGTCTGATCCAGTCAGCGAGTCCATTAAAACTGTTTCACGTGGCTTCTTTTCCTTCTTTGAACCGAGTGTACGGAAGATCGACTTTTTC
GGAATGGATTTTTTGTCGGGAACAATACCTTCCGCGTGAAGCTTAGCAATCTGTTCTGTCAGCTTAGTGTTTTCAGCCTCAAGCTGAGCAATTTTCTTGT
CCTTGTCACGCACAGTGTCCTGTAGCTGACGGACCTTCACATGGTTGCCAGCCGAGGAGACCTCCTTGTCATTCTTGAACTTCTCAATTTCCGCTTTCAT
ACCCTTCATCGCAGCCTTCATATCCTCGTTTTTCTCACGAAGTTTCTTGTTCTCGTCTGTGAGAGTTTCGATCATACCACCGGCATCAGCCATAACAACA
CTCGAGGCAGCGGAAGAGTCCGCTGTCGTCAAGCTGTTGCGACGCTGCAGTTGAGCATTACGTTCTTGCTCGTCTTGTAGGGCAGCCTTAAGCTTATGCA
ACTGGTACGCCATATCTGCCTCACGGCGCTTTTCATCGAGAGCAGCCAAATATTTTGGCCGCTGGATTGTCATGCGAACCAGGGCCTGCACGCGAATGAC
CATCGCGCGCATCTTAACGTAGCGATGACGCTTCACAAAACCACGCACATATCGCTGTATAATAACAGCGTAGTGATTACTCTTTATGTCGGCAGCCACC
TTGCGGCCTTGGACGCCTCGCCAGCGAGCTTGCACCACGATGATATTTTTGAGAACCATGTTGTATCTGCGCATTGCAATCACGCATCGGATGACCGATT
GCAACTTTATGATTGCCTCAAGTTTTCGAAGATACTTGATGCGCTGCGTAAAGCCAAGCATGGTGTATTGCAGGTAAGTGGCCTTAGCATCTAAGAACTT
TTTGCGgcgatcttcaagctcttcaagcaCTCCCAGTTGGAAGTACACGCGGGTTTTACCCATTTGATATTGACGAGGGGATTCAAGCTTTAGTTTGTCC
ATAAGCAATTGACACTTTTCTTCAACTGTGTGGCCACCACTCGGTACAAACAGCCAGAATTTGTCCAGAATCTCGGTGTGCTGCAACCGGTTTGGGTACG
CCGCACGCGAGATGCGAATGGCTTCAATAACACCAGCGCATCGCAATTGAGACACTACCATGCTCTGATCCATCACAGTTGCGCTTTTAATCGGGTTAGG
CTTGATACAACGCACGTAGTGCACACGTGTCGAATTGATTGTAGCCATCAGTTCTGTCAAGCTCTCTTTGAATTGAGTACCAACAGTCGTTATTGACAAA
GCTCCACCCCGCTTTCGGCGGTTTCCTGAGGCTTCCGAATCAGCTTCACTTGGCTCTGGCTTGGACTCGAAAAGTTTAGCGATAAACGGCTTGGACGATC
CACGCATGAGCTCAGATAAATCCGGCAGAAGTGAGTCTTTGTGcttctcaagaaatcccaccGAGTCATACATCACAGGAGCAGCATAGTGCTTGATGAG
GAACTCGGTGCGAGACGTGCGAGGGAATTCGATGACATGCGTTTCATCCTTGTGCAATGATGTTACTTTGGACATAAACGACTCCTCATTACCCTTTGGT
CGCATAACTTCCTCGTTTAGCAGTGATATTATACCCATCCGCGACTCGATTACGTTCAGTACATCCTGATTATCGGCGTACTCGATGTGGTCCCACACAA
TTCCTTCCTCCTCGTACTCGATCTGCACGGTCTTGAAGACATCTTGAGTGAATTTTTGTTGTAACTTCTCGTTGGCAAAATTGATACAAAATTGTTCGAA
TGAATTGTGTTTGAAATGTTCGAACCCGAAAATGTCGAGCACACCCACGTGATTGGCCATATGGCCATCATCAGCTAATGACTGGTTGATTGTATTCACA
AGCCAATCAAATACATTCGAGTAAATAGCCTTGGCTAGGGCATCACGACAGTCCATCGCCAACTCTTTCTTTAGCGGCACACTGTACACATCATTGGCCG
CACGCATGGTACGGGAGCAAAGTGCCGTTTGAAGAGCTTCCCATGTGACACCAAGCATGTGCGTTGCAGAATTAGCCCCACCGTCATTTTCGGGAATCAG
CGACTTTTCGTCATCAGTAGGATCCGATTGCAGTTGCACTTCACCAAGGTGAAGCACACCAGCCAACACTTCAAATAGTGGTTGTTGGTCATCACGAGAC
AAGCCCACGAGCTCAAGAGCTTCTCTTGTCTTGTTAAAGTGCTTCTCGTCTGACAGACCTTCAATTTTTTGGTCTCTATTGTCGCCCGTATACGAATAAA
TTTTGGACGATTCGAGCTGTAGCTCTGATGAAACGTCAGAAGAGTCAATAAGCTGATAAAAAATGTGGTAGTTGCGCTCAGGTGCTTCGTGATGAATTAC
TCGCGTCTTTTCCAGGAGATACGTGCGACATTTAGCGCCAACAAGAGTtccattttcatcaaattgCAACTGTGTAAACTTGCCAAATCGGCTCGAGTTG
TCATTGCGGACAGTCTTGGCATTTCCGAAGGATTCGAGCAGCGGATTGACTTCTATAATTTTCTTTATAGTTGAGTTGTTGAGACCACCCGCGATTGTAG
CCAAATGGTTCATGAGGATCTTAGTCGTCTCTGTTTTACCAGCACCGGACTCACCACTAACAAGGATGGATTGATTTTTTTCCGAGCGCCGCATATTGTC
ATAAGCAGCAACGGATGTGGCATACACGTGTGGCGGAAGTTCCTCTTTAGGCTGGTTAAGGTACCGCAGATGCTGCTTTTCAGCGTAAAGATCCGGTAAC
CATTTGTACGGATTAACGGCGATACAAATATCCCCTGTGTACGTGTAAGGAAGCTCACAAAGAAAGCGCTTTTTAACATTGTACAAAATGGCGGCCTCAT
GCAAGTAATTAAGTGTGATCATGTCCTCGATTCCCTCACGTCCGACGTTTTCGTTCTGATAGGGAAGAGATTCAAGTTGGTGCACATCCAGCAGTGCCTT
GGTTTTTTTTGCCAGCATATCTACACAGCGCTCCTCGATTGTACCGTCGGGTAACTCTACCCGGCAATAGATTTTGCGCGTCTTGCCGTCACCCGAATTC
TCGTCACGAAGCACTTCAGCCGCAAGCCACACGTGTGTTTCGTCCGGTACGAAACATTTTGCGCCCGTCACCATCTGTAAGTCACTCATGATGTCTTGCA
ATCCTTCTCGGTGGCGTCTTACCAGTTCGATAAAACTCAGAACGCTGGCGCAATGGACAGTTTAAAGCGGAATGGGTCAAGGGGGGGGGCTGGCAAGATA
CCGTACACACCGGTAAATAGTATGGTACATGAAGGTGTACTGCAATCAGCAACCAGTTTCTTATGACATTGGTATCTGCACCCTGATCTGACAATAATAA
TTGTGATGACATAGCCTGGCCAACGCAGCTGGCACCAAGCCGGCTGGGATTGTCAAACGGAGCATCAAATTTAAGAACAATGCCGCTGCGCCGCCAGCAT
CCGCCACGTAGACTACGAAAGTGTTATTTGAGACATATGAATATGGTCACAGTAGTGCCTACACAGGCTAGATTCTATCACCAAGGCAATTATCCTATCA
CCGTACAAGAGGTCTCATGGTTGTTTTCTGCACCAATATGATTTACCGTCAAATACCGGT