Description :
From Genome Similarity Track
Location :
Scaffold_13:141231- 143301
Sequence
2070 bases(100 bases per row)
CAGTCTTGGGAGGCCTTGCGGGAGTCAGCGAATCCCGTATACGACACCGCCTGCGAGTACGCCGACGTCTTCCCGGATGAGATTCCCGTCGAGCTACCGG
CGGATCGTGGGGTTCAGCATGAGATCGACCTCGCGCCAGGTACGAAGTACTGCGTTACCAGACAATGGCCACTTCCGCGTGATCAAGTGAAAGCGATCGA
TGACTTCTTCGAGGGCCGCCGAAAGGCGGGTCACGTGCGTGAGAGTACCTCTCCCCATTCCAGTCCAACGTTCTGTGTGAAGAAAGCTACAGGGAGATGG
CGTATCGTTCACGAATTCAAAAACAAATTGAATGATACCACCATCCCCGCACAGACTCCGATCCCTCGGAAGGACATGGTACTGGACTCCATGGCTGGCA
GCGTCATCTACAGCGCCATCGACCTGACCGATGGATTCTATCAGATCCTGATGAGAACATCTGATGTGCCTCTCACCGCCGTAAGTACACCGAGTGGGAT
GCTCTGGGAGTGGCTCGTGATGCCACAGGGCCTCAAGAACGCGCCTGCCACCTTCAATCGCATAGTCTCCCATGTGCTTCGCCCGCTTCGAGACTTCGCG
CCGAGTTACTTCGACGACATCTTCGTGCACAGCCACGCTGAGGGCAACCTCAGTGCCGTGGACGTACATCTGAAACACCTGAGACAAGTCTTCCAGGTGA
TGCGAGAGAACAAGCTCTACGCAAACCTGAAGAAATGTGTCTTCTGCGCACCGGAGATTCCGGTGTTGGGATGCTACGTGAGCAAGAACGGTGTGCGCGC
GGATCCCGAGAGGGTATCGTCTATCTGTGCTTGGCCAACGCCGACAAGCCCCACTGAGTTGCGTCAGTGGCTTAGCATGGCCAATTACTTGCACAAGTAC
ACGAAGAATTACGCTGGGTTGATCCAGCCACTGTCCTCGCTGCTGAAGAAGGACGTGACTAGAAGTGGAAATCGGACCACCAAGCTGCATTCGACTCGGT
GAAGAAGAGCTTGGCGTCTGCGCCGATACTGAAGCTTGCTGATGACTCAAAGCCATTCCACGTCGTCTGCGACGCGAGCGATTTTGCCATCGGCTGTGCG
CTGATGCAGTTCGATGATGACGAACACGAACGCGTTATCAGCTATCAGTCGCGCCAACTGAAGCCAGTCGAGAAGAATTACCCAGTCCACGACAAGGAGC
TCCTGGCAATGAATTACCCAGTCCACGACAAGGAGCTCCTGGCAATGCGGTACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGTGAACAGTCATTTGC
GGCTTACACTGATTACGCATCGCTGCGGACAGCGATGAAGAGCCCTCACTTGTCGCAACGGATGGCCCGTTGGCTGTCATTCTTCTCCGAGTACAACTTC
GTTGTTCACTACAAGCCGGGCAAGAATAACATTCTCGCCGACGCGCTGTCTCGGCGTCCGGACTACGATCCCCGTGAAGCGCTAGGACATCAGCTCGCTG
ATGAGGACGACGACGAATGTGCGGTCTGCGTGTCGTCAGGCATCAACTTGATGTTGACAACGCCCACGCTCCCGCTGGGCGACGAGATTGCTACAGCGTA
CGATGATGACCCTATATACGGCGCCATCATGAAGCACCTGCGTGCTCCTAGTAGTGACACGCTAAGTGCCCTGTCAAAGACCACGCGGAATCAGATCGAT
CGATATCGACTGGACGGTAATCTGCTCAAGTACAGCATCGACAGGTTCGATGGACCTCGAGTCGTCGTCCCAAACGACGCTGATCTACGTGCGCGCATAA
TCCACGAGTATCATGACGCCCCGACTGGAGGACATCTCGGTCGCGAGAAGACGTACGCGGCTCTGTCGAGAGACTTCTATTGGCCGCACATGTACAAGTG
GGTACGCAAGTGGGTCCGCACATGTGAAACTTGCCAGCGAGTCAAACCGTCTTCGACGTCTCAGGCCCCATTGCGCCCTCTTCCGGTCGCCACGGAAGCC
TGGCGCTCCATTTCGATGGACTTCATCCTCGGTCTTCCGCCCGATACAGCCGGGCGCACAGGTGTACTTG