Description :
From Genome Similarity Track
Location :
Scaffold_1:141204- 145235
Transcript NameFunction/comments
Phyta_totarag44hypothetical protein PHYSODRAFT_553621
Phyta_totarag45protein kinase, putative

Sequence
4031 bases(100 bases per row)
CGCCGTTCTTCGTGGAGACCGGAGCTGAATGGAACAACACGAACATCGACTTTGATGAGTTGAGCGCGTTAAGGGCGCAGTGGGagctgccagcagcgtg
cCATATtctctggctgctgcagagtcCTCTGacgctgcgcttctcgaACACGCTGCTTGAGTAtgaagcagcgctgctgaagcccGAGGATAGTCcggtg
ctggaagacgtgtTCACGAAACTACTGCTGAAGAAAAGTGAGCGAGCTTGTCTGAGCGCTGGTATTGGACTTAAGTACGAGTGGTGGAACAAGCAGCTGC
GCATTTACTACCTTGACATGTACGACAAGTGGTATGCGCTACTGCGCAAGGCTGGCGAGCGACTGCCGGAAACCTTTTCGCaagatgaggacgatgatga
cagtAGTGTCTCGGACAGCAAGACCGATGAGCAGGTGGATGTGGAACTCACGGACGATGAGTGGTTGACACTCGATATCCTGAAGGCACGTCTTGAAACG
CTCGGCATGGTTTGCCCACTAAAGGTGCATTTTTTATCGAGTTTTCGGCTTCGCTGGTGATGATACGACTCTTAACATCGAACTTTTTTTTTGCGTGAAT
ACATAGCACCAGTCATTTGCAGACTTGTCGATCGAGCTGCGATGCAAGATTCTGCTAAACTTGTGCGAGGCCGTGGTGGACGATCCAGCCAATACGTACG
TATTCTTCGTGTTGTCATTATGTTTATAAGCGCTTGTTTCGAGCATGTTCTCACTTACTGCGGTTATTTTGTGATGGGGGTAAACAGTGAATATATGCGT
CagatggaagacgacgatctACGCGTGGATCCACTTGGCAATGACCGTGCTGGAAACATGTATTATTTTTTTCCACAGTTCTACGAGGAGCGACGACTGT
ACAGATTAGATCCGGAGACGCAACAATGGGCACTCTGGGCAAAGGGAGACGACGCGTTCCGCGCCATGCTTAAAGCAATGAAGGAAATTCGCGGACGAAA
AATTCGCGGCGAGCAAGAACTATTGGATCACCTGGAGGTCATTATAGAGCAGAttgaggacgaggatgaagcgCGCGCACGGCAACTGGAGAAGGCTAAC
CGCCTAGCGATCCTCGAGGCGATTCCGcgcaagcgctcgctgcgtcttcaggtgaagcagctggtgaagatggaAAAGCACCAGGAGGAACTGGAACACC
AGAAGGAACTCTCCATGGAGGAAATAGCAGAAATGAAGCGCGCGGAGTTGCTACGTAAGGTTGAGCGCGAAGCTGAGAAGGAGGTACGCGATGCCGAGCG
CGAGGCACGCCGCTTGCACCGCGAGCAGGtagagcgagaagaagcccagGCTGAGCGCGAGAAACGTCGGCTGCGCCGAATTGAGAAGGAATTGGAGGAA
GAAAAACTCGAGCAGATAGCTCAGGAGGAGCGCAGgaagcaggaggaagcgCGCGAGCACCGCGCTCGCCAGCGGCATGTAGCCGAGGAGTGGCAAGAAG
TAGACcaggaggacgagagcacagtggaagaagcagcaccaatCACCGCAGCACTGGCCCCCTAGCAGgttccagcgccttgaagGGCCCCGAACACATC
GGTGGCGACACCAGATAAACATGTATTCCTCTGTAACAAGCAATAGAGATCAATCGCTCCGCAGTGAGTGACACAGCATCGCGACTACTACTGTACCTCG
CCCTCTGCTACAACGTGCAGCGCGCGTGTTCAAGGTGAAGTCAAACTTCGAATCTTGATGTAGAGGATGAAACGCAACAACATAGCCGTGTTCTTGACTC
GAAAGCGCGAAGTAATTCAGCCATGTCGATTTCCAAGATTTGGCATGGCGTCATTATTGAAAACCCCTATTTTGCGTTGCAATGCACGCAGAGAGCGACC
TCAGTGAACCATTGATTGGCATTCGTCAACTCGGTAGAGACATCCATTGGGCCTTGCTTTGCTTTCGATTCGATTCCGTTCCGGACGCTGCGTTTTGGCT
CTGGGACGCCTACGCCGCGGATACATGTTGATGCTCGGAAGCGCGAGATACAATGGATTGTCTGGAGCCAGCAATGCCCGCCGACCAGCTTCGCTGCGca
ggtggagctggtcgGCCGGGTTCACGCTGGGGCGGCCAAATTCCAGAGACGCGCTTTTTGTACCCATCATTACAGTTGATGCAGCGTGGCGTCGTTTGGT
GCGGGGCTGCCGGCTTGGCTCAAGCCTTGGGGCACCAACATTACTTGCGATGTCCGTTCAGACTTTCGTTCACGTGTTCCAGGACAGAAATCCTCTAGAC
CCGCACCATATCATCCCAAAGGTGTCAGTCCGTTGACGCGAATGAGCAACGCCAGCGCCTGTCAAGACATGGCAAACCCCTGATGTCCTCCGAGGGTTGC
CGTGTCTTGACGTCACCTCGTGCCCTCGAGCTCATGCAGCGATCTTTCTTCAGATGTGACAAAGGCGAGAAAGTGAGCAACGCCGCCTCGTCGTGCaact
attattaataatagcATGGTATACAAATGCATACACCTTGCACTTGAAGGCAAGTCCACTGCAAGTGCACTGCCCTTCGCCCCAACCCACCGCCAACCCA
CTCGACACCTTACATCTATCTCCTCGAAAGTTTGACCCCCATCCAGGCGAGCTCTGGATAGGCTGGCCTCCTTAAACCCCTTTACCAagtctctctctct
tcgaAGTGAGTGGCGCTGCACCTCTTCATCGGCTTCAGAACGAGAGATTCCTGCGACAACCATTTCCAGGAAAACCTCAGCAGATGGTGCGGCATCCATA
GAAATGAAGGTAACAATTGAGGGGTGCCCCTTGAAGTACCATGACATACTGAACCCAAGTACTTTGTGGACTCAAGTGTCGATGTTGCAGCCCAAACTTC
ACACTCTGCAAAAAACTTCGCATCGGTCAAGTCGCTTGCCGTCACTAGGACACATTATACATGCTCAAGCATCAATACGAACCGCTGGAGACGCTTGCGC
CGGCGCTCTTTGGCCACGTGCAGAAGTGGCGCCACATACCCACAGGCGAGTACGTGGCCGTCAAGAGCATGGAGCTGCGCTTCGCGGCGCGCAAGCGCTC
CAAGAGCTCCGAGCGCGCGGTGGACGAGGACCTATTCACCGAGATCAAGACGAACCTGCGCGTGCAGGCGCTGGGCGGCCACCCCAACGTGTTGCCGCTG
CGCGACTGCATcatggaggacgaggccgtgctgctcgtgctcaagTTCTGCCAACAaggcgagctgctcgacgtgcTCAACACGAAAAGAGCTGCTCGGC
AGCCGGTTAATGCGCTGCGTTACTTTGCGCAGACGTTACGAGGCGCAGCGTTCCTCCACGTCAACGACATTGCACACCGTGACTTGTCACTGGAGAATGT
GCTGGTAGACGAGCGGGACTGCTGCCACATCACGGACTTCGGATTGGCGACGCAGTGCCAAGGCACAATGACAGTGAAACCCGTGGGCAAACTTAGGTAC
ATGGCCCCGGAAGTTAGTGCAGCGTTGGTGTATCAAGATGCTGAGTCGAAAGAGTACGACCCGAAGGTGGCAGATGTGTGGGCACTGGGAGTGATGCTGT
ACGCCATGGTGGCTGCCCGGTATCCGTTCCGTGAACCACTGCGTAGGGATGATCGGTTCAAGTTGTTGGAGGATTTCGGGGTGGACTATTTGCTagagaa
ggacgaggtggaggtgcaggGGAGAGAGGAAGTGGTGGATATGTTGAGGAAGTTGCTGGTTGTTGACCCGGCCAAGCGCTCCACGCTTGCAGAGCTTGAG
TCGCATCCCGCGTTGCCTGCTGTGGATGACAATGAAACGCGACCTGCTAACCCGACTGTGACAGTGTCGaaggtggagcaggagaaacCGGAGGACTCTG
TGCCACAGGTGACAGTCACAAGTAGTGAAGAAACTCGGCAGCGCACGCGGTCGCTTGGCCGCTTTACTGGCAAGGGATCACTCGCTTCAGTGAGCCCCAA
CGCACCACTATCAgaggcggagaagaacaag