Description :
From Genome Similarity Track
Location :
Scaffold_20:141203- 145227
Transcript NameFunction/comments
Phyke_g1286hypothetical protein PHYSODRAFT_354328
Phyke_g1287hypothetical protein PHYSODRAFT_259509

Sequence
4024 bases(100 bases per row)
TCAATCGGTAGTGAAGCCGTacacctccatctccacagcagcgtaGAGAACTGCCTTGAGCTCTTCTCGAACAACATGAAGCGGCAGGTCCAAGCGGTTG
AAACAAGCGTGGCTGTGGATAAAACCGTCTCCTACAAGCGTGACGGCCTTTAGTGTGAATGGACAAAGTCGACCATCGTAGCTCGTCAATGCACTGAACC
CCCCAAGCGGCACGCGGGAAGAACCGGTTGCGAATTGAAGTAGCCGACGTCGATACTCATTAGGCATATCTCGAACGAGCTCCCAGAACCATATAAGTGc
acggtgctggtgcagttcTTCTGTGTATTTGGTGCTGCGCTCCCAGTCGTCCACATCAATTTCGTCAGAACCACACAGTAGAAAATCGAGTTCCTCTGGA
TCAAACAACAACAGTAGCTCGCGGGGAATGATTTCATACAGCCCCTGGAGAAACACCCCGAGCTGCGGCGCTACGCTCTCGACCAGCAGGAATTTCCACT
TGCGCTCCACATATTCGTACTTGTTGCCATCCGTCACAGAGATACTACCTCCCCCAGGCACCAGCTCGACGTCTCGGTAACCTTCTCCATCCTTAACCGT
CACGGTAAAATCAAGACCAAGCGTATCAATCTCCTGGTTCTCCAGTAGCCAAAGCAAGCTAGTGTACATTTCTGGGTCCAGGTCTTCCACATCAGCGAAG
CTAAGGGGGTGGCCCAATACCAACTTTAGCAAAGGCGGTGCTAAATGAAAGCTCATCATGGACCCTTCAAGCAATGCACGGCCCAGTAGACGGCCAACTG
CAAACAAATGTAGCAGCTGGCGTGATTGATTCCGGTTCGAACAAGgactcaagaagaaggtctGCTCGTTCTTATTGAGGCACACGAATAGGCCGTTCTC
GGGATCCACGAGCATCTCGTTGAGCATAGCAAACCACTCACGGTGTAATCCCCCAGCATCAACCCCGCTTTCGTCGAGGAAATTGATACGTAACACGGAG
TGAACGTTCTTGGAAGGGATTATGGTAAGTGACTCCATCGAATCTTCAAACAGGTTAGCGCGATCGACATTCAGTCGAAGGTGCTCCCTTTCAGGAGGTA
TCAGTATTGCCGATGTTGCAGTCACAAAGTGCGCGTATCTGGAGGGGAAATCCTTGGATGATAGCGCCAATGTTTCGGAAGTAGTTGCCGATGTCGCCAC
CTCGCTTTCATCCAGCAAAGCCTGGTTAGAACTGATCTCAAGATCCAGAGGCAACTTGGAGGCATCCGAATCACCGGCGGGGACAAACAAAACGTGTAAT
GCTTTAATCCCTCTCTTTAGTCTTGCAATGCGTTCCTCAACGGATCTGACAGCAGGCGGTGGGACCGGAGGGCTGGTGGGACCATGATTGCCCCCCATCA
TGTAATCGTCCTCTTGATTAGGCTCGGGGATTGAAACTTCGTCCGGTGACAGCACTGATTGTTGCTCAATTTCAGTGGTGACTGACCCATCCAAAACCGC
ATCTGTGGATTGGAACTTCGCTACAAAGCCTTGAAAGCGTGTGTCACCGCTGTATCTTCCGTCCCGAAACCAGAACACACGTCCCTCTACATCCATTTTG
CGTATCCACTCCTTACGGCGCTGCGcacgaaggcgacgacgagaaggttGTTGCTGAGAAGGCAGCGAAGTTGGAGCTTGTGAAGTGGCAAGTTGTACGC
GATTATCACGTTTAAAGAGCGGTATCAATGACAGCCGAAgcgatttcttcttgtccgtcTCAGTGGAGCTACCATTGTCGCCATTTGGCTCTGAATTCTC
CACGATCACCTCGCCACATACGATGCAAAATCGGAACCGCTTGAAATTCTCAAAGCCGCAGACTCGGCACTCGTTGAAACCCTCTTCGGCATCCCTGTGA
ATCTCAAAACACCATATATATCTTTTCAGAATTGTCCGCCTCCTCTCAGCACCAGGCTGCTCGCTACCAAATGAAAACTCACCGTAGTGCCGCATCTAAG
CGACGATCGTCAGAGCTACATGTTTATAATATAATGTACCATTTGGTAAGAACGAAAGTACACAAGACTGAACTACTAGCAATGAGTTAAAAGTTTACTT
AAGGAGAGGAGCATGGAGCTCCAATGAACGTTGGCGACGGATGAAAGAGCGACGTGCCAGCACACCAATGCACACGAAGATGAGCACAACGACCAGGACC
AGCACGATGAAGCCCACAGCATCCGTCATTTTGGCCTCGAATGTTGTTTTTTCCCTTACATGTGACACCGTGTTTTGTAATAGAATACCACAAAACATAT
TGAACACATAAGTTAACTGTTTTTGAGGAATGCAGTAAAGTCAATGAACATAAAGCTCCTGGCTAGCTCCAAGACTCTTGTGTCCCATTCGTGGATGGGC
TCAGAAGCGGTCGGTATTCAGATGCTGCATCTCGTCCGACCGTGAATCCGAACATGCAGAGGAGTTGGCTGGCGTATTGGCCACAACGCAGCACGTCGtc
caaagcagcagcgggcCGAAGGAGAAGGTTTCGACGTGTCGAAGGTAGAAGACGGTGAGGACAGCCCCAACTAACAACACCACTCGTTAAGTGTACTGAA
GCAGAGTGACTGATATCATGAGAAGGCTTCAGCATACGCTCCATCAGCTTTTGCGGGCCATGCATGAGCGTGCTAAACTGCTAGGGCCCGAAGTGCATAT
TGCAGGCGATACAAGAGGAGCAGCATTACCTTCAATGTGCTGTCCCTGTGCAAACTGACCCTCATATGCATAGTTATTCACAAGAGAAATTGCGCACCGA
CCAACAAAGCTGCGTGACTTGTTCAATACTTGTATGTGTACACTATGCTGTCGTGAAACCCGTCAGATCTGTGTCGAGTGTGGCATACAGCATCTTCTTT
AATTCCCGTTTGCTATGATAGAGAGGGAGGTCCAAACGGTTGAAGCACGCGTGACTTGAAATATACTGGGTGGTGCGGTAAGACACACCTTTGAGGTTGA
ACGGGCACAGTCGACCATCGTAGCTTGTGAGTCCTCGGAAACCCGACAGCGGCACGCAGGCAGAACCAGTTGCAAACAGCAGGAGGCGGCGCCTGTATTC
ATTTGGCATGTGCCTCACGATCTCCCAAAACCAGTTGGTTACATTAGCTCCCTCTAGGTTGGGAGACAACACAGCGTGTGTTTGCCAGTCTGTCACGTCA
ATTTCAGGAGACCCGCACAGCAGATAGTCAAACTCTTCTGGATCAAAGATCAGCAGGAGCTCGCGAGGGATGACCTCGTACAATCCCGTTAGGAACGCAT
GCAGTTGATCCGCCACACTCTCGAAGAGGACGTATCGGAAGCGTCGGTCCAAATATTCCTGTTTGTTAGCATCCGTCACAGCGACATTCCGTCCATTCGG
AATCAAGTCCACTACGACCTTCTCCGATCCGCTGATCTGCTCCGTCAAACTGAAGTCGAGGCCAAGGTCGTCCACATCATCGTTGTCCATTAACCACCGA
AGACTGCGGTAGGCTTCCGGGTCGAGGAATTCCATGTCAGCAAGCGTGACGGGAACGCCCAAAATTATCTTGAGAAGTGGCAGTGCGAGATGGAAACCCC
AGATACCACCTTCTAATAGTGCTCTACCAATTAGGCGACCAGTAGCAAAATAGTAGGCGAGGTGATCCTCGCCCACCTCGGTGCGCGACTGAGGATTGAG
AAAGTAGCTCTGGTCGGCATTATTTGTACAGATAAAGAGGCGCAGCGTTGATGATGCCAACAGCTCGTTCACCAGCATAAACCATTCGCGGTGCACACCA
CCGGCATCCACACCACTCTCGTCCAGAAAATTAATGCGCATGAAGGAACGCAAGTTCTTCGGCTGAATACAGAACATGTGGTCCATAGACTCTTCCAGCA
TGTACTCGCGGTGTATTGATAGCTTGAGAAATTCGATTTCCGCAGGAATAATCAGTGCAGCAGTGTTCACCACAAAATGCGCGTACTTTGATGGAAAGTC
ACTGGTGGCGATCGAGACAATCTC