Description :
From Genome Similarity Track
Location :
scaffold_898:1412- 3866
Transcript NameFunction/comments
Pl_101937NA

Sequence
2454 bases(100 bases per row)
CTCGAGCCACACAAGAGTTCTATCCTACATGACGGATGAAAAGATTTTCACTCCTCGCCCCATGCCGCAAGGCAGTAGCAATACGGCTATCTTTTTTCAA
CAGATCATGGAAAAAGGTTTCGCTAGTCTACTCTCCGAACGCTTACTCATCTGGATTGATGACCTCCTTCTATATGCCACCGACATTGACACCTACCTCG
TTATACTGAGCGAACTATTCTCACTCCTTAACCAATTTGGGTTAAAGTTGAGTGTGAAGAAGTAGAGCTTATACCAGACGCAAGTTAAGTAGTGTAGCCG
GGTTATCGATGGCAAGGCATTCGCCACGACGACCACCGGATTGACTCCCCATGTGCGATGACATATCCTCGTACAGCTGCAGAACTCCAGCAGTTCATAT
GTGCTATCAACTGGATGCAGGACAGCATCATCGACTACGACAGACAAGTTGAACCCCTCCAGCGACGACTCGACATTGATCTTGCTCACACAAAGCACAC
AAGCGAGCGGCTGCAAGCATTGAGGTTGAGCTCGAAATCACGAACGACAAACATTTGGTACCATCAAGGAGGCGTTGGCGAACGCAGCCACCCTCGATTT
TCCTGACGACAAGGCAACTACATGTCGTTTTACAGACGCTTCGGATGCTGGCTACGCTATTGTTGTTACTCAAGTCTTGGACTTCGACCCGTTGAAGCGA
GTAACAGAGCAACAGCATCGTTTGACTCACTGCACAAGTGAAAGATTCACTAGTAGTCAACGCAACTGGACTGTGATAGAAAAGGAAGCATTTCCTATAG
TGGTGGCATGCGATAAACTGGATTATCTGCTATTACGACCTCGACCTTTTAGGATGTAGCGCGACCACCGAAACCTAATTCACATTTTCGGACCTCACGA
GTTGGTGAAGAAGCACGTCAAGGGCAAGTAGCTTCGGTGGGCGATGAAACTTATAAACTATAGCTACGTCGTGGAGCATGTGCCTGGACATACCAACGGA
TGGGCGGATTTGATAGCTCCGTGGGCCGGGAATCATACCCCTACTCTGAAACGCTTGAGAACGACTCGAGCTGCACCTACCGTGGGTTAACAGCCTGTTT
CTGCTTTACGACCACTAGATGATGACAATTTCGTATGAAACAATGCAAGCGAAGTATTCGCCTCCCGCTGATTCAGTCCGCAAAGCGGACGATTTGTTGA
TCATTTGTGGATTCCTCCTGAGGAAACAGACCTCATTCAACGACTCTGTATCGTGGCGCATTGCGGTGCCCAGGCCACCGTGACCAGTACCCAGTGATCG
TCCATTTACGTCTACTTTTCTCCATTGACCACATCACATACATAGTGGTTACGTTCGTGAAAAACTGTCTGCTTTATCTACATTGGAAAGGGGAAGGTTG
TGCCCCGCCCGTGGAGCGAGACGATTGAGTGTAACACGCGCAATAGTGTTTTGCATTTTGACTATCTCTACATGGGTGAAAGTTACGGTGAGAGCAAATA
TCTGCTCGTTCTTAAGGATCACGCTAGACATTACTGTGAACTGATGATAGCAGACACACCTGACAGCGTTGCGGTTGTGAAACCATTGTTGGCTTGACAT
TTGAGGTTCGGGATCCCACCGGACTGGTTCTCGGACAATGGTATTCACTTCAAGAACGAAGTGGTGGCAAAGCTAAGCAGACGTCTTCGCACTCAGCAGA
CGTTTGCACCCGCATACAGCCCATGGATCAATGGATCCATTGCGCGTGTTAACAAAGACATACTCCAAGTGGTGAGAACAATGATCTTGATCTACAAGAT
AAGCTACAAGGACTGGGTATACTTGGTGCCCAGGATCTAAGCGAACCTGAACCACACTCCCGTGCCATCGTTGGGAAATCGAGCACCTGTGGAATTATTC
ACTTGGGTCTAGTGTCCTACACCACTGCGGGAATTTTATTTGCCCGACAAAGGCGACTTGCAAGAAGTTTCGGATAGCGCACGGATGGACGAGTACCTCG
ATGAATTACGGGGAAGTCTCCAGGCGATGCACTGTGATGTGGAAGATCGCCGGTTGAAGCAGCGATTGCTTAACAAGAAGTAAGAACGAAGATAAAACTT
CGTAAACTTTACCGTAGACGATTTCGTATTGCTATCTCGAGTGGACGAGAAACACGGAAACAAACTACAGGTGATCTGGCCTGGCCCCTACTGAGTCGTT
CGTGCTGATGCACATTCATTTAGAGTACAGCAATTAGTGACTGGTGTTGAATTGGACGTACATGCTTCAAGGATGAAGATATGCGCTAACAGCAGTCTGG
ATGTGACAGATGAGATTCGGGAACATGTGTCCTCGAAAGGAATTGTCCTATCAGTCGACAAGCTAAATGAACATCGATGGAATGATGACATCTAGGACTA
CGAGATGCGAGTTAGCTGGAAAGGACTCCAGCAGATTGAAGATTCGTATGAACC