Description :
From Genome Similarity Track
Location :
Scaffold_2502:1412- 2624
Sequence
1212 bases(100 bases per row)
CCTCCTAATCCACCCTCCCCCTGTAGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTTCCT
GTGGGCCCTTCTTTATCCTCCCATCGACATGACCAACTCACACCCACTGCTCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACG
ATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGA
AATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAAC
TATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATCTACGGCCGATCCGGATATTCTTTGACCAACTTCAG
CTTGGATACGTGTACTACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCA
TGCCATAGGTGGGCTAATTTGCGGGCATACCTCTCTTTCACTCGATCCAAATAAAGCCAACCTGCGATCCCACTTGGATTTGATGTGGACGGGCATCTTC
GTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGCTCACCTGGGATCTAGCTTGCCAATAGTATTTCTGGACTTGGTATCGCCATCGC
CTTGGATCTTGGTTTCTCTTCTTGGTGCTGCATACTGGAATGGCCGCTTCTAGGGTGGATTTGGAATCCCACCCATGTACCAAGTAAAATAGGGTATCAC
CCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGC
CCTCGTGATTGTCTGCACCATGCGTTCGGCCGACCCGCTATCTTGGGGACGGTATGCCATAGTCGCCCACTGTCTCTGTCTCAGGATCCGGTTGAAGACT
CGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGCCGAATCATCTCACTAGCTCCAAATCTTTGACAAACGCACTCCTTGTACGATTCGGCGATGG
TTTGTGCAGTTC