Description :
From Genome Similarity Track
Location :
contig_222:14119- 15742
Transcript NameFunction/comments
g14328.t1ETI53385.1 hypothetical protein F443_03630 [Phytophthora parasitica P1569

Sequence
1623 bases(100 bases per row)
CCAAGGGCAACAACTACCACGAAGTGAAGACTCCTGACATCGGAGAGCTCGAGGATGGAGCCATTCGCCCGGGAGGCCCACCCGACCTGTACAGCTGGCG
CAACATCGGTCTCATGGCGCAGTACGCTGCCGTCGGCGTGGTCTACGGCACCATGTACAGCGCCATTTACCCGTTCCTGACCAACTACCTACGCATGTCG
GGAAACGAAACGACGTCCGCGAGCGTCTTGATCACGTTGCCGTACACTCTCAAGGTTTTCATCGGCATTGTCACGGATTGCTACCCGATCTTCGGCTACC
GACGTCGTCCATACATGCTCATCGGCTGGGCCGTGTGCTTCGTATCCCTGGTCGTCATGACCGCCTTGCCTATTGGAGACCCGTACTACCCGGACTCCAG
TTGGGCAGCCCTAACGAGTCTCACGGCCGAGCAAACGGCGCAGCTGAACACGGACGCACAGCACTCCGGGGTCAAGTATATCTTCCTCATGGTCATCGCC
AACTTGGGCAGCGTCGTGGCATTCACGGCTTCGGACGGTATTCTCGTGGAGCTCGCCCAGCGCGAGCCTCTGAAAACGCGTGGCACGCTGCAGACCGTAG
TGTACGCGGTGCAGTACAGCTTCCAGATCATCTCGTCAGCGATGATCGGCTTTGGACTCAACAGCGGTGACTACGGCGGCACGTTCTCCGGCTCCATGGG
CGTCAACGCTGTCATGGGGGTGTGCGCAGCATTTTCGCTGGTCGTGATGCCCTTCTCGTGGTTCTGCATCACTGAAGAAAAGACTCGACGTTCGGCTCGG
AAGTACCTCTACGCGCTGTACGAGCTCATCCAGCAGCGCGTGGTGTACCAGATCGTCATCTTCCGCTTTTGCCGGAACGTCTTCTCGTACGTGAGCGTGA
CGGCGTCAAGCTTGGTCCAAAGTTACTGGTTGACCGTGAGTCCTGTGAACAGCAGCGTCGCAAGCATCATCGGTCTGCTTGCGTCGGCCGGCTCGCTGTA
CCTGACGAAACAGTTCGGACTCAACTGGAACTGGAGATACATGATCGCGATCTCACAGATTGCGGTGATTGTTATCGACGCCTTCCCTACCTTCTTCACC
ATTTGGGACGTATACCGCAGTCAGTGGTTCTGGCTTGGTGTTCCGCTCGTCGAGAACTTCCCAAGCGCAGTGGGGACGATCGTCGCCACGTTCGCCGTGC
TGGAGATCATCGAGGAGGGCAATGAGGCCACGGTCTACGGTCTTATTACTGCTGTCTCCACTTTGGCGTCTCCGTTCGCCAGTGTTATCACCAAGAGCAT
CGACGGCCACTTCGACGTAGAAACCGACTACATCCGACTGGACAACTCGTACGTGCGCTGGCAAGTGACGTACACCTACTTGATTGCCTACGCCTTCAAG
CTCTGCTCGCTCGTGTTCCTCGTGCTGCTACCAAAGCAGAAGGTTGAGACGCAGGAGCTCAAGCGCACCGGAGGCAAGAACAAATGGATTGGTATCGGCA
CGATCATCGTCGTCGCCTTTTCGCTCGTCTGGTCCGTTATGACCAACCTCATGACCATGTTTGATAGCACGTCCTGCCTCCGCATCGCCGGTGGATCAGG
ATGCTAAGCTAGATAAACGAAAA