Description :
From Genome Similarity Track
Location :
scaffold_3:141187- 142395
Sequence
1208 bases(100 bases per row)
CGCATAGTCaggacgacgtgacaatgcgTCTGACAGCACACTCAGTATCCCTGGCTTATACGCAACCGTAAAGCTGTATTCGGCGAAGAATGACAATCAA
CGAGCCATACGCTATGACAAATGGGGCGACTAAACTTCATAGCTGGAACTTTCGTGAGTCGTGCTGACGATAAACAGAATTGACCCCAAGCGGTGAGCAT
GAATCTTCACCAGAGCAAACTCATTGCCAAAAGCTCCTTGCCGTGGACATGATAATTTTTTCTGCTGTCGTGATGGAAACGACACgacacgacacgatcg
tgtccttctgAGTCCTTTTGTAATAATGCACCACCTAACTACAAACCCAGAAGTGTCACACACCACGCTAAACGCTTACGTATGAACTGGTAAAGCAATT
AATGGCGCCTCCATCAAACAGTTATTGGGTGAATAATTCATCACAAGGAGATGATTCCCATGGTACGTCCTTCTTCTGCAAGTCTGATAGTGGGCGTACA
ATTTCCGCGTAGTTACGTCAAAAACGATGCAGATAATTGGACAACCCATGATTGCTTTCACCTTCTTATGGTCTGTACGAACGCCGTGTTCACCAACATA
ACAACCGAAGACCGGTACTTCGTTAGCACCCAAAATGAACTTTGCTATACCGCTTGCAATGAATATTCACGCAGATATTCTAGGTGCTCCAAGTGCATTT
CTTTGGTAGATCTGCCATCTCGACCCTCGAATGAACGAACATATCGTCAAGATATGTATGTGCAAAGCGTCGCGGTGGTTGAAACATATGTGAGATTAAA
taattgaatgttgctggggCATTGGATAGCCCTTGCTGCATCACAAGCACCCCGATTACATACCGGACGGTGCACTAAAGCCGTCAAAAGGACACTCTCC
TCCCTCATTAAGATTTGGTATAACTATAGACCAAATCAAGCACACTAAACTGTGTACAGCCGGACATACGGTGGATGATGACATCTTTATGtggaatcgg
cgtttgcgcGGGGATCATCTGCGCATTCAACTTGTGAaaggcgtgaacgatacgctatATACCATTTGAAATACGCACACAAATGTTGGTGCGCTGtgag
gagacttgctctcccaCGCCAAACCGGCAGCTTGCTTTCACGCGATAGTGACCACTGTCTAAGCACCACATGCTTTGAACCAGGTTCACGAATAACTTCG
TGTCAAAC