Description :
From Genome Similarity Track
Location :
contig_222:14117- 15739
Transcript NameFunction/comments
g14857.t1ETI53385.1 hypothetical protein F443_03630 [Phytophthora parasitica P1569

Sequence
1622 bases(100 bases per row)
CCAAGGGCAACAACTACCACGAAGTGAAGACTCCTGACATCGGAGAGCTCGAGGATGGAGCCATTCGCCCGGGAGGCCCACCCGACCTGTACAGCTGGCG
CAACATCGGTCTCATGGCGCAGTACGCTGCCGTCGGCGTGGTCTACGGCACCATGTACAGCGCCATTTACCCGTTCCTGACCAACTACCTACGCATGTCG
GGAAACGAAACGACGTCCGCGAGCGTCTTGATCACGTTGCCGTACACTCTCAAGGTTTCATCGGCATTGTCACGGATTGCTACCCGATCTTCGGCTACCG
ACGTCGTCCATACATGCTCATCGGCTGGGCCGTGTGCTTCGTATCCCTGGTCGTCATGACCGCCTTGCCTATTGGAGACCCGTACTACCCGGACTCCAGT
TGGGCAGCCCTAACGAGTCTCACGGCCGAGCAAACGGCGCAGCTGAACACGGACGCACAGCACTCCGGGGTCAAGTATATCTTCCTCATGGTCATCGCCA
ACTTGGGCAGCGTCGTGGCATTCACGGCTTCGGACGGTATTCTCGTGGAGCTCGCCCAGCGCGAGCCCCTGAAAACGCGTGGCACGCTGCAGACCGTAGT
GTACGCGGTGCAGTACAGCTTCCAGATCATCTCGTCAGCGATGATCGGCTTTGGACTCAACAGCGGTGACTACGGCGGCACGTTCTCCGGCTCCATGGGC
GTCAACGCTGTCATGGGGGTGTGCGCAGCTTTTTCGCTGGTCGTGATGCCCTTCTCGTGGTTCTGCATCACTGAAGAAAAGACTCGACGTTCGGCTCGGA
AGTACCTCTACGCGCTGTACGAGCTCATCCAGCAGCGCGTGGTGTACCAGATCGTCATCTTCCGCTTTTGCCGGAACGTCTTCTCGTACGTGAGCGTGAC
GGCGTCAAGCTTGGTCCAAAGTTACTGGTTGACCGTGAGTCCTGTGAACAGCAGCGTCGCAAGCATCATCGGTCTGCTTGCGTCGGCCGGCTCGCTGTAC
CTGACGAAACAGTTCGGACTCAACTGGAACTGGAGATACATGATCGCGATCTCACAGATTGCGGTGATTGTTATCGACGCCTTCCCTACCTTCTTCACCA
TTTGGGACGTATACCGCAGTCAGTGGTTCTGGCTTGGTGTTCCGCTCGTCGAGAACTTCCCAAGCGCAGTGGGGACGATCGTCGCCACGTTCGCCGTGCT
GGAGATCATCGAGGAAGGCAACGAGGCCACGGTCTACGGTCTTATTACTGCTGTCTCCACTTTGGCGTCTCCGTTCGCCAGTGTTATCACCAAGAGCATC
GACGGCCACTTCGACGTAGAAACCGACTACATCCGACTGGACAACTCGTACGTGCGCTGGCAAGTGACGTACACCTACTTGATTGCCTACGCCTTCAAGC
TCTGCTCGCTCGTGTTCCTCGTGCTGCTACCAAAGCAGAAGGTTGAGACGCAGGAGCTCAAGCGCACCGGGGGCAAGAACAAATGGATTGGTATCGGCAC
GATCATCGTCGTCGCCTTTTCGCTCGTCTGGTCCGTTATGACCAACCTCATGACCATGTTTGATAGCACGTCCTGCCTCCGCATCGCCGGTGGATCAGGA
TGCTAAGCTAGATAAACGAAAA