Description :
From Genome Similarity Track
Location :
contig_16:141153- 144064
Transcript NameFunction/comments
g4214.t1hypothetical protein

Sequence
2911 bases(100 bases per row)
GGACTGCCCGAAGACACAGAGATAACAAACAGAGCAGAATCTTCTAAGTCCAAGAACAGCGTATACTTTCCGGTAAGTCCCTGCGTGGGCTGGATTATGT
CTGCCGTCGTTCCCCGAGAGGCATAGCTTGTAGGGGAATCGACTGGTAGCGCCAAGAGATCAAGGTCGGCCCGGGGTGGGCAATTCTCGCTACCAGCGAA
GACAAACCTCGTCGAATCGACGAGTCGGTGGGTCTGCACAACCCAGGACACCGCAATCTTCTAGCTGAGCGTACTCTGCGCTCGGTGACCTGTAAAAGCG
CTAGCGCGCCGACGTCCATCCTTTGGTGGAGGTCACAGGGTTTGAGGAACGGAAGCTGCCCCGCTCAGGCGAGCTTCTGGAGTTTGGATTGGTACCCAGC
GAGAACAGGGCCTCAACTGGACCCGGCTGGGCCGAACCGCAGAGGGAACCAACAGAACCCCGCGCAAGCCCAACAACGCCGACCTGACTCGGCGATTTGT
TGTGTTGTTGCGTGGAAGCCGCACTAACGAAGTTTTTGTGAATCACAACACCACAGTGAAGAAGGAAACGAGGGACTCGAATGCCTGACATCTTACTCCT
CCAAGACACACAAATGAAAACAAACCCAGAAATTACGAATATGACGAACCAATGGCAGCGTGTATGGCAGGTAACCAAATCTGACAACGACATGAGCTAC
TGGACACAAAATAAAACAAAACCAGCAGGCCTAGGAATTCTAGCCAGCCCAGCCATCAGCGCACGAATAAAACCTTGGTAGCAAGCAAGGTGGACATCAC
GTGTAATAGCAGTGGAACTAGATGACTGACTAATAGTAAATGTATATGCACCAGCTCAACGAAGTGAACAAGACCAATTCTACGCCGACCTCGAACCTTG
GATATCTCAACACAAATCTGTGATCATCGGAGGAGACTACAACTGTGTACTGACACCACATCAAGATCGCATAACTGGACGCAAGCCCAGCTCGTCCCCG
AATGAAAGCAAAATACTTCAAACGATGCTGGATAAATGGGATTACTCCGACGCGATCAGCCTCACCAGACACCTCAACGACGAGGAAGAAGACCATGACC
CAATGCATTTCTACACATGCTGGGCCCAAGATGGAGCCAGCAGACTAGATCGCTTCTACGTAAAAGGTGAACCATTCACAGCGGTACAGTGGGTTGATGT
AATAACCGCAGCACACGACTCCGATCACGGAGAAGTACGACTCGAGCTATCCACAGGAAAGCAAGCCCCACGAACCGGAAAACAACAAATCCACTACACA
ATCCGCACAGGACGACCCACACGTGTACCACAAGCAATAGCCACCGGCTTAGCAGAGGTAATGGAGTGGTTTCAACAGGCAACCAACGCTATTGAAACAT
GGGGTCACATCACAGAAGAAATACGACAACTACTACAAAAAGTGAAACGACATGATGACAAACAAAGTCGAAGATACTTTGAAAACCTGTGAGCATCAAC
AAGAACGGTTAGAACAACTAGAGCAGAGATCCATGAAGCAGATCGAAAAAAAACACGAACCAGAGCGGCAAGATCCTTCGGACAACACCTACAACTGACA
ACAGAAAACACACGGCGCCTTTTCAAACTAAACTCAGACTGCCAACGGGATCAAACAATCACAACAATCGACTCGTCACCTGGACACTTTTACGCGGATG
AATACCCAGTGGAAGAGAGAATGGCGTCCGAGTGGAGCCACGTCTTCGGACAGTCTCACGCAAAAGTGGAGCCAAACAGTAGAGAAGAGACGTTCAAACA
ATTTGTTACCATCCCCGAAAGCCACAAATTCACACCAGCAGAAGCCGAAAAACTAGTGAAGCAGATCTTGGAAGGAGAAACCAGAATGGCGATTGAACAC
CTAAATAGGAACAAGTCAGCTGGAACCACTGGACTAAATCACGATTTCTACAAAGACTTTCAGAACGAACTCACACCAGGACTCACTAAACTTTTTAACG
CTTTTCTGGATGGAGCAGGGTACGTACCACAAACGTTCCTAGACGCGACCGTAGTCCCACTTCGGAAAAAGGGGGACTCAGCGGAAGCAATGGACTACAG
ACCAACAGCTCTCCTCAACACAGCATACAAAGTTTTCGGGCGAATATTAGCAGAACGACTACATCAACTTCTACCCAAATTAATTAGTGCAGCGCAGCAG
GGGTTTGTCAGAGGACGATCTATCGACAAGACAATAACCATACTACGAGCAATACTAGCAGAAAGCGAACACAACCCAACCAAAGCATGGGCAGACTTTG
CGGCAGTACTAAGCTTAGACCTACGGAAAGCGTACGACACGCTAGATCTGGCATTCCTCCTCATGGTCCTGAGACGATATGGATTCTCGGAAAGGTTTAT
AGCAGTGATACAGCGACTACATAATAGAACGACAGCGATCATCTTCTTGGTTAACGGGCAGTTATCAACTAAATGGACAGTGGCTTCGGGCATCAGACAA
GGATGTCCTCTCGCGCCACTCTTGTTCATTCTGGCGGTTGACATGCTCAGCAGAGTAATCAACCAACATCCAAACCTAACGGGATTAGCCATCCCTGGCA
GCAAAACGCTCCACTATAAATTCTCAGCATTTGTTGATGCAGCACAGTGTACTTGAAATCAGCGAAGGAAATACCGATTGTACAGAAAATCCTGAAGGCG
TTTGGGGAATTATCTGGACTACAAGTACAACCGCAGAAAAGCGTACTAATAGGATTGAACACGGCTGGGACTCCTACGAAATGGCATAGATTCCTGGTGT
TACAACCAAGAAGACAACAAGATATCAGGGGTACTGGGTAGGAAACTCAGATCCAACCATGGAGAACTGGAATATTCGGATCTAAAAACTACAACGACGC
CTTCGAATCGC