Description :
From Genome Similarity Track
Location :
scaffold_24:141133- 142368
Sequence
1235 bases(100 bases per row)
tcctcgttatTCCACCCGGGAAaagaagtgtcagactcgtagttgaCCACCgccacatccccaacgaggtcactcgtaaGTGATAGCGTGCGTGGAgagc
gacgctcgggctcatcgagcccaaaattttcatcccttgatgccgcggacacacattccgacatggcaccgcgtgcggaagacgaagttgggctctaccc
gtgtgcgctgtcggaaccagcgagacttgaagacttcggtgtcattgacacagggctcattgagcacagaAAGTGTTTCAAttcaacgcagtgtctaacg
gacacgcaagcctcgttgaggcaataatcgattgatactgtaaatgctctcaatcttaattggggagagtgtaccgggcataccctggtaacagggttgt
gtatcacaccagatgggcatggcaTGACCACACCCAACCAAGAAtatggtacggggctggatagccagtagatatacatgtatttagattttactctaca
tatttaggaaaaactATGCAtgtaaaattaggcggctttgccgcagataaaaataaataaattcagTTTTGGGTtttaacggaagagttaataagccttg
gattaaggcattaattactcttggagttagcgatttgcgatccgctaaactcgtaattgtctaagtataaaacggaaggttggtgacctaacttacgctt
actcaaagcgcaaagctacggcagctccgctgcaaatTTCCTTCGTGCTGTGACCACTGACGACTTGCTTAATCAGTACGCGAACGGAATACATACTCGG
TGTCACTTTCGCCAGCTTCTAGTGCCCAGCGTTCTTTTTTACAAAAGATGCAGATTTCCCCAAACGTTGCAACTCCAAGCGCAGACCGTGCGCCTGGGTA
GAAGTGATGACATGTGAGAAAGCGCTCGCAAAGCAACTTTCTGGCGCTCATTTTGATCTGGATGCGCGCGAGGGCCCATATGCACATGCGTGTAGGATTT
ACGCACCAGCGCAACAGGCAATTTGAGATGGCTGGAAACCGCAAAGAAGATATTTAAGTGTTTATTAGTTGGCGTGACCTATGCTCTTGCAATAGAGTGC
CTCCTCCATCGAGAGCGGCTCGACCGTGTAGCACCAAAGGAGGGGGAAGTGATTTCTGGGGGTCGGAGTTACTGAGACCGTTTAATTGGACAACACCTTC
GTTAATTTCATCAAGCGCATCGGGTTAATGACCGC