Description :
From Genome Similarity Track
Location :
Scaffold_4:141128- 145313
Transcript NameFunction/comments
Phyca_LT1534559780protein kinase
Phyca_LT1534503502predicted protein

Sequence
4185 bases(100 bases per row)
cacgtttggctgcgcctgcacagacgccacctgtgactcacaggctgtgagaaacaaggtcttcaaacagaccttcgcacagagctggtgcagcgatctt
taaagggtgcataggtaatcgcactgatgacgaggaggtggagcagtttgcgaccgcgacatcggagccgcattcctgcgtctagagttaccgtggtgtg
cacagcaagcaccaaaaacagtagcaaactcttgagcagtgcgctccatctcgccccattcactcgcacaattcccacaccgacacaaacgccgacgctc
tcgtattttctgcagcatgcggtctgcagtggaaagagcctgttgcacagtctcagctttcgtccgttttgcctgggcatagttcgtggttgctgctcat
agggacaagcagcgaaacattagcatcgaaactgcacagctcctcacaacaggctcttaccaatccgctgccatctcttcacctgcgcgtacgcactgtc
caattcgcgctggatttcatgcagtcgacgtctgctttgatcgagtttctgtcgttgctgcaccaagttgttctcgagtcggaaggaatgactcgacgtc
atgcactgtatctggtacatacggtccagttctcttctcatctcgttcatacgctcaggtagacgcgatctagtagcagtagttgattccttgctgggtg
tacaaaacgaagaagtctcacagtttaaagcccctttgtctactgctcctccgacgaacagatacagttgaacaacgttgttcgggctagctttgcgcct
gcacactggacaagcatgtcgtagcgcaagagcttctttcacgcaggtgtgatggaagacgtggccacatcgcaaggttgccaagtctttctgcaaactt
tcgaggcaaatagcacaattgctagtcatttcaccactgtcagaagctggacgtgcagcagatgatgaagcatactgagcccgatacaacgccatttcga
aagtgatcccaaaagtttgcgagccaagacattgatgggagtagatggaagaaaagaacggagaaagagaagaaacccttgtgccacgtcccgcgagttt
aaatctttcaagggctactacatgctagtattatactttttttcgttggttatgtattctatctcggcctatatgtgaagcatggcggcgatataggacg
cgctgggacgtagcgatgggtcgtattgcaaacacgcacctgccagttccctgaccatcgtggggcattcaggcgtgaaagtgaacatccccataaaact
ggtatcgacattattgtgagttcccagaactggagtagttcttcgtcggttctcctccagagcaaggcttcgagaactttgaattacgcgcgcaccgttg
gtactcggcaagctttcgagatgagtggtgcgacgtcgtgaactgtctgaatcgggcgtattcgaggatacaactgtgccgtcggtagataaaaccgtgc
cgttgtccgaatcgaaatcgccaatgtgagtccgcattctccacgaacttctaatcatttcatccgctgtctggcacgtatccaagtgagcaagcagcac
accaaacgcatacatgtccgaggacgaccgagaaggctcgccaatcaaaatttcaggagcgaaaaaagccttggaggtggagtcgcaatttcggtagtag
gactggcaagtgtatggtgacgagccatcggtagggagcgcagcttgaaccgggttcagcttgcatccctttttagggtcgacaaacacgtttcttccgt
tcaatccgtcatacgtgaccatgtgctggctgtgcagatacatgagccctcgtgcgatctccgctgctgctttcatcttgaagttcttccagttgagctc
agatccagcactccggagatacgcttcaagcgtgcccagtgtcatgtactcacacacaacagtcatcgcatgcctctcatcccaaacgagtccagtaatc
gtaagcaactgggggtggcgcatttgtgaaagcgttgggaccatgtccaaagcggcttccacatcatcgtcactaggctgaagctttgtcacgagcacca
gctttgtacgatgctcagcaagtgccaccaccacagggccagaggttgataattgattaagcatcaccatgtctgtggctggaatctccttgaatgcagc
cttgcgcaaccccccgccagtgttaaactcgttcaatgatgtctcgagctccgtagtctgcacggaggtaccatttccacccattcgcgctcttaggctt
ttcaggttagacttaatttttccatctccagacacgagggaatcatgttgctcctgcgctaccgttttcttccatcgtcgcaggaccagcacaccgccta
ctacagccagaactacaaaaagcgtaaggccaagaacaacaaacagcgttacagaactgctgctgctctcgctagctgtagatgatgtactctcttcctt
ggaacctgagctgttgatgctgccgagaccgtctccgttcgtgtagcacacactgttatcgccccatgatacagcttcgtagccagttgagcagctccca
tcgactgtaagattcgcttcgaaaacgggcagttcttgtagatactggagttgcgggagagtgacgtgagcattggcgatggtgttgccttgcaggtaca
aggcggacaggttgcgcatttcataaataatggtggggatatctgacaattggttgtcacgaagatctctgttgcgacgacacgagaacaagttagatca
cctcacaaaaagagcatgaaggcctacttacaaagtggacactgaagtgaaagcgtgtgatccacgtggatcaaattgtgtgagcttcgaccgttggatg
atactgtataaaaggaaacaagttagacttagacgagcgacgaaaaactttgaaaatcaaaacttgcatcgtctgaagagagtccggaaagatgttggtg
agcatatcccccacatcaacgtctgaaataactctggaaagcagcaacataatgtaagtaagcatgaaactcacaacaatccaaacactttacacactta
cagacgctgcagaccggtgccgttgcggaaggcgttcgacgaaaaagagagcgggacagcgatctgcgaggttgccgtcgcgccgacgatcgtactgcaa
atcacaaccacgcaatgcacacaaccaccaaggtcaaatgatctaccaaacatcagcctcgttaactcccacgtacaggttcagcagagtcgatggaagc
gttaggtcgtcgatctgttggaagacagccgtgtcagtcttgtcgctctggggctgggcgatcgtaagcgtccactgaggcgtgccccagctagcccacg
tgtccacaaggcactgcacctcgcagtgtcctgccgtcacatcagtcttgcacgtcggtatgctagcggtcgagcaccctcgattgtaaaaccctccgtc
actgctgtccttgtttctggcctcctcagttgatgccgcgtagttcacacacagagacgaactgcacgccccataacaatgactagtgagcgtgttgtgc
tccggcggattgcatacggtgtccgcagcgccaaccctggcaacgatcattgccaaaacggccacaagcccccgaacgctgcgcatttcacgtggttctg
ctgtaaacttcagtagaataaaccttggaccgtgtggtacttgtattgggcccctcgtgcctctggaacctaggttagcaacgtagagagaactcacagt
cagacattgtgatgcagtggagaagcgactgctactggactcctaccgacgcgaaccgcgtgattttttcgcggcgatagtagctgtacacagtggttgg
agagtgctctgcgtcacgaaggctttgaggcgcaggggctcacacgtatccactcggaagacgagcgggtaatggagcggcactgccttgtgtcggtcca
cgaccgaatgtcacagtgcggcagcttgtgcataaccagggtgtaaagccagttgaaaaacgattgataatttgtgattggtggaaaaagccgcctgata
acaaattcgtttcatttttgtgtagatttgacttgtgctcactatacttgatagctctggccgttatttagttgctggttcaacc