Description :
From Genome Similarity Track
Location :
Scaffold_56:1411- 5324
Transcript NameFunction/comments
g17874.t1POM76437.1 Reverse transcriptase [Phytophthora palmivora var. palmivora

Sequence
3913 bases(100 bases per row)
CATCTCCAGCTTGCATAGCCTGGAAACGGGCTCTTGCGCACGCACCTTGGTTGAACTCGTATAGTAGAGCACCACAGTTAAGCCTCGACACAGGTAACCA
TTCCGTTTCATCGTAGCCCTTCCATTTCACAAGGTATTCGCGAGAGCGCCTTGATGTCCGAGTTCTCTTAGTCCAGCGTAAATCTAGGATTTGCTCGACT
TCATACTCGTCATTCTCTACGTCAGGTTCCCAGCTGTCTTCTGGTAACAAGGCTGCGTCGAAATCGTCATCTTCCTCCACGTCAATTTCCACAGCGGGTC
GCTTTGGGAACAATGCTCTAGGCTTTAGTCGACTCACATGCACCCAAGGATTAACACGATATCCTGAGTTCTCAATCCTGAGTTTCACTCTGAAGTCGTC
GTGCATTTCCTGGATACGGAATGGACCATGCCACATGTGAGCTAGTTTCCGGCTGAGTCCGGGCTGCACCTTCGGTATATATAACCAGACAGCATCGCCC
ACAGCGAAGCCAGCTCTCAATCGTTCGGACAGTTCTTTCCACTTCCTGGTCTGCTCAGCAGAACGCATGCGTTTAGCCTTCTTTTGCAGGTCTCTGGCAC
AAGCCTGAGCGTAGCTGTAATCACGCTGCAACTTCCGACGCCAGTCATACGCAGTGCGTTCCTGGACGCTCGACGGCTTGGGTTCAAGCGTAGCAGACAC
CGTATCGTGTGCGTCCCAGCCGTGCACCAGGAAGAAGGGGGTATCCAGTCTCGTTGCACCGAACGATGAATTGAGCGCAAACATCAGTCGTTCTGCGTGG
TCATCCCAGTCACTCTGGTCGGCTTCCGCAACGTACGCGCGAATGCTTCGCACCACAGTCTGCACAGATCTCTCCTGCTCCTGCTGGCCGTTGGCTTGAG
GGTGGTACGCCTGAGTGGCTAGCTGCTTGCTACCCAGGAGTTCTCGGAATCGCGTGAAGACCTCACTCATGAATCTTGGGTCCTGGCCATGTCTTATCAT
AGAACTCGCTCCAAACCTCCTGAATACGCATTCTTCATAGACTTCAGCGACATCTTGGGCCGTCGTAGAACTCATGGGTTTACACATCACGAACCCCGAA
AACATGTCCTGGAATAGGAGCAAAAAAGTGTTTCCGCGATCCGACTTAGGCATGTGCGTCACAAAATCCATGGACACAACCTCGAACGGTCGTCTGGGCT
CAATGTTTCCAGGCGAAGGTCCAGGATTTGGAGGACGCCCCTTGCCGCTGGCGCAATCTACGCATTCCTTGACGAACTTCTCAACATCGGCATACATACC
GGACCAGTAGAATTCAGAACGAAGCTTTTCATACGTCCGCGTGATCCCTTGGTGTCCACCTTGGAAATCCTCATGTGCATAGTGCAGCATATCGGAATGT
AGACTCCTTGGCACGACTAGTCTGAGTTCGTCGACCATGTCACGTGGGCGATCTCTGGTAGACCGACTCAGGCGGTAGATGACTTCCCGAGAGTCAAGCA
CGAAATCATCGGCGACTTTAGCAAGCTTCCTGGTTTGGGCGTGTGACATCTCTGTTACATCACCCTTCAGGAAATCCTTGAGTTGCATCAGGAAAGCGTC
CTTGTCTTGATGCAGCTTAATACGTCGCCATCGTTCCGCTTGGTACTCGATCGGGCCCATCACATCGCCTTGGTCTGGTTCATCCTGAGGTCGTGCACGA
GTTACGGCAACAAGCACCTTGGCGGCCAGTGGCAGAGGTGCGGACTCTGGTCCAGGGAGATTCGTGGAATCAGCATCCTGGCCATTGTCGTCCTGCACTC
CCGCATTCAGGGTTTGAGCGGGTTTCATCAGCTTCTCGTGGATCTTGGACACCAATTGCAAGTGTGTCAGCTCGTCCTCGTCCTCAACCTTCCAAGACTC
GTCAAGCAGTAGCGTCTTAGATGTCAAGTAGTCTGCCGCCTGGTTGAATTCACGCTTAACGTGCACCAGTCTGACAGACTTGAATCTTGGTCTCAGAGCT
TCATACTCGGCTAGTTTCCGTTGTAGGTTTGGTTGGTGACAATTGATCAAGCCTTGTGCTTGTTGGATGACGATCCTGGAATCACCGACCACAACGATCT
CCTGGACGTCATGTTCTAACACCATGTTCAATCCCTTGAGCAGCCCACTGTATTCAGCATCATTCACGGTCACATCTTCCAAAACAAATCCTTGTGCATC
TAGGACCTTCCATCCAGGGAGGCGCCACAGAATGCATCCGCAACTGCCACGGCGTGTAGACGTTTTGGCGGCACCGTCGAAACTCAGGATGTGGCCTTCA
AAGTCAGCACCCAACATCTCCAGACTAATGGGAATTATTGGTGCGACTCGACCCTTAGCCGGGATCAAATTCTCCGCGACTTCGTCCAGGTGTTCTCTAG
GTGTGATTCCTGCATCTAGGATGGCAGGTAGTCCGTCTTCATCACGTTGCACTCTGCGGATCTCCAGATTCCAGTGTGACAGGATTACGCCCCACTTGAC
GTTCTTACCGTCTGCCGACTTGGATGTCAGTAGCCACTTAAGCACAGAGTATCGGGTGTATACTACGATCTTTGGACTGTGTTCCACCAGATTCCTGAAC
ACTTCTAGGACTCGCATGATTGAAATCACTTCTTTCTCGGCGAGCTGGTATCTCAGCTCAGCGTCGTTCAGGACACGCCCCGTGAAGCGAACCGGATGAA
TGACTCCATCGTACTCTTGGCCTAGCACCGCAGACGCTGCCCACTGATTAGCATGCGGGATGATCACAAATGGTCGTGTGCGGTCAGGATGCCGCAGTAG
TGGAGTCGATACAATCTTGCGCTTCAGGATCTCAAACGCTTCCTTGGCTCGCGACAAGTCTCGTCCAGCACGTATCTGTTCGTCCGTCAGCTCATATAGG
ACAGCGGCGATCACGGGGAGGTCTTCGATAAACTTATTATAGTAATTCAGACTTCCCATGAAAGACTGCACTCCCTTGAGTGTCTTCGGGAACGGCAAAT
CCTGGACTCCCTTCGCAATCTTTGGCTTCGCCCGGATACCTTCAGCACTAATTTCGTGCGAGAGGTACGGGATGGACAACTTGCCAAATTCGCTCTTGGG
TAGACTTACAGAGATATTCCAATAGCGTAACCGAAACAGTAAAGCGTTCAAGTCTACACACAGGTGATCCCATGTTGGTGCACCATGAGCGATGTCGTCA
ATGTACGAGCTGCGCCCGAGCACAGGGCCCATCTGAGGTGGGGCTGGGATGTTACGCTGGAAGACTGTCATCTTATCCGTCAAGATCGAGAAATCCTCCT
CAGTACTATCAGGACTCCTGGGTTCCAGAGGATCAAGTTTCAGGAAATCAAGTACGTCAGGGTCCACCTTTGCTTCTTCCTCAGAATCCAGGCGAACGAA
TCCCCACAGACAGTTGTTGATGACTGCTTGATAAATGAGTGGGGCGTTCTTTAGGCCAAACGGCATCCGGATCCATTGGAAATGCCCAAACGGACACACA
AACGCAGAGATCAGCTTGGCTCGCTCGGTCATTAGGACAGCCCAGAATCCACTTGCCATATCCAGACTCATAAACCACATGGCCGACTCAAAACCAATCA
GCAAGTCGTCAATGAGTGGCAGAGGGTAGTGTAGTAACTTGATAAACTCATTCACCACACGATAGTCGATGCACATCCTGATGTCAATCCCATTCTTCTT
CAGAACGATCACAATCGGTGATGCCCACTGCGATTCAGAATGCTCGATGAGTCCGGTTTCCAAGAGTTTCTTCAAGAGTTCGTACACCTTGAGCATCAAG
TGAGGCGCGATGGATCTCGGTCGCTGAGCAACAGGTTTCGCATCGCCGACGTCCAAGTCACAGACCACTCCACGAGCAGGTGCAGGAGCAGCATTACCGT
CACCAAGGAAGAT