Description :
From Genome Similarity Track
Location :
Scaffold_469:1411- 5134
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20322hypothetical protein

Sequence
3723 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCTATTGGTGGTTGTCATGGTGATTGTAAGTTCTGACACCTCCTCCGCCGCGAGGGAGTGGAAGGTGAAGAGATTCGCGATAGCGTCT
TCCGGATCTTCACGAGATGGCCATCTTCCTCTTGATCTTGGCGGGGCTCTTCGGGCTGTACGCAGCGCCCATCAACATCATACATCTCCTTATTCCAGGA
CGTACCGCTCTCCTGGAGATGCGAGACGATAACGTGGGTCCGGAAGCCACCATATGAGAGCAACTGGCCGCGAACTCACCAACAAATAAAGAAATTCTTG
GCCTGCGATGTCATGAATTTCTCCACTATCAAACAAAGGCTGTACCCTATCAATCCAGGTGAAAACCGTTGCGCGCAAAGTCTCTGGAATCGAACATTCC
GCACGTGGGAGAAAATACTCTCCACCCTTGAATTAAAATCCACTAGCGCTCTGACAACTTCAAGAGGCAGAGTAGTCAGATAACACCCCTCCATCTTTTC
GTTATTCCACCGTCCTCCTCACCGAATGCTGGCTTCGGAGGCTCCTTGAGCTTCTGCAATCACACACGAGCTTGTTCTTCGGATGTACGTCACCTATTAA
ATTAATCATAAACAGTATTAATCCATGTGATGTTAAACAGTGTGATCCCAGATGTGAATTCGTGTGATTCCGTGTCACCTGTGAAATCACGTAACATGAT
AAGGAATGTGATATGTGAAAACGTGTCATCCAAAACCTTTTGCTGTTGACGCCGCAAGCCTTCAATGCCTTCTTCAAGCCGCTTGCCTGAGCACTATATG
AGATCTCGCGGTCCTTCACTTTGCCATCAATAAGCTGGATGTTATACCACGATGAGCGCCTGGGAACGCCACGCCCAGAACATGGAACCGCCAAAAGAAA
TACATGGCTAATGCCCCGATCGGACAGACCATAACATCGCGATGCCTTATGCAGCCACCATACTCGATCCTGCCGAATTGGTTCATCTTGCCTTGGTCCA
TAACAGCAAGGGCAGCCACACATTTTGTGGGGCCCTAATTTGGTAGCTCCATAGAAAGCAAATCCGGCAACTGGAACTTTCTCGTTGTCTCTCCTCGTGC
CATAAGCGCATGCCCGAAGAGTAGGTCGACGCGATCCCGAAGCCCGCGTCCAGAGTTCTGTTCCATGAAGTACCCCGCAACATTCTTCAACTGAGCACGC
GAATAGGTGTCGTGAACGGTTCCCTTGTCACGATCATCAAACTTGTTACGCTTGCGCTTGGCTCGTTCTCGCTTGTGTGTCCGAAGGTACACTGAGAGGG
CTTTGCCGCGTGGATGGGGAATGGAACCAACCCCCAGCGACTGCTGGGTGCTGTAGAGGTCAACCAGCGCCTTCACATAGCCTTCAAGGCCCCGGCAGAC
AGGGGGACGACTTCACCATCTTC