Description :
From Genome Similarity Track
Location :
Scaffold_8:141088- 144115
Transcript NameFunction/comments
Phymu_g629hypothetical protein

Sequence
3027 bases(100 bases per row)
AGCGGCAGTATTgcacggctgctgctgctgggcgtggcCTTCCATGTGCTCTGCATCTTGAGTGCGTTCGACATCTACTTCCAATCATCCGTGGAGTCCT
CCATCCGCAGCGCCAACTTCACCTCGTCGCCTCCCGCCAAGCGAGTCGTCATTTTCACCCTTGACGGTTGTCGCGTTGACAAGCTCTTCAAAGTCGTCGC
CGGCCATGCCGACCACTACGATCTCAACCCGGAGAGCACTGAGACCGCTCCAATCAACTCTGACAGTCGCGTACCGTTCCTGGGTCAAATGATGAGGACA
AAAGGTAGTTGGGGAGTCTCACACAACCACGCACCGACCGAAAGTCGGCCGTGCCACGTGGCTCTGACCGCAGGGATGTACGAAGATCCGCACGCTGTTT
acaagcgctggaagcgacATCCAGTTCCGTTTGACTCCGTTTTTAACCAGAGTCATAATGCCTTTATCTTTGGCAATAAAGATGTTGCCCCGATATTGGC
TGCTCACGCTCCACAGGCCACGGAGGAGCATTAcactggacgagaagagGTCGAAATGGCTCGAGAAGACACGACGCTACTGGATGTATGGGCGTATCGC
AAGATGAAGGAGTTGTTTGCAAGAGGAAAGGAAGCGAAGAATCCGGCATTGTACGAAAAGCTCCATGACGAGAAGTTGGTGATTTACTGTCATTTTCTAG
GAACTGACTTGACGGGGCCGAAATTTGGAGCCGATTCGAGGGAGTACTTGGAGAATATTGCAGTGGTAGACGAATTGAtcgagaagacgcagaaAATGAT
TGAGGAGTACTATGGAAACGATGGACAAACCGCGTACGTGGTGAATGCCGACCATGGAATGGATCTTGGAGGGGACCATGGTGACGATGCTCCGGAGAAA
ACACGGACGGCAATTATTGCGTGGGGTGCAGGTGTCCAAGGACCTGAGACTGCAGGGAAAGCTGACAAGAAATCGTTTAAAATTGATTTACCTACGCGTT
CTAGAGCCGAGATACAAAGTCGTCTTGGGGGGcaagaacatgaagagcAGGTTGCTGCTCGTGAATGGGGATCAGTGCTAAATCTCACGCGCAAGGATGT
CATGCAGACAGATGTGGCAGCTCTGATCTCTGCCTTGGCGGGACTTCCTTACCCCCGTAACTCCGTCGGAGTTCTCCCGTTTACTTACCTGGTCAAAGAT
AAATACCGCGCAATCGCGATGCGCGCAAATGCTCGACAGTTATATGAGCATGCGCTGCGCAAGGAAGAGGTGAAACGAGCGCGCCGGGGATTGCTATTTG
CTCTATATTCACCTCTCCACGACCGAGTGGCAGAGCTTGAAGCTCATATTGATGAGGCCATTAACAGCATCAGCGAAGGCGAAAGCCACCCAATTCACGA
TGATGCTTACCGCGCCGTCGAACTGTTGAGCCAGGAAATGATTGATATTTGTCGGAACGCGATCGTGTATTACCAAACGTACGACTGGCTGTATTTGCGG
GGATCGATCGTGCTAAGCTGCTTCGGCTGGGCTTTAGTCATGACGGTTGCGTACCAGAAGCCCCAGAAATTTCGCTCGCGGTGGTTGTTGACCCATACGA
TCGACATCAAGCTCATCGCTGCCGCAGTTGTAATGATGTGGTGGCGTTTTCTCGCGGATTCTCCGTCCACGCACTACCTGTACGGGTTGTGCCCTCTTAT
ATCTTGGAAATTTGTGTGGAAACATCGCAGACAACTTCGGGCTGCGCTGCCTCCTATGGGTTCACGCTGGAAATGGAGTGTACAAGTTGTGTCAACTTTC
TTATGCTTGGAACTTGTCGTTTTCGGCTATCATCGCCGTGAACTATTTTGCCTGCTGTTTATTTTATTGGCGTTGCAACCGAGAATCATCAGCAACAATC
TCCTTCACGCAAGGGGTAGCGTCCAGTTGAATGGCCGTTTACACTGGAGGAAACTGTTGACGCCAGATTTGTATTGGTCTACAAGCTGCGTCTTAATCGC
TATTTTCCCGTGCTTGCCGAGTGAACACGATCGAAACACGCCGTTGGTTCATCTTGGTGCATTGCTGATATTGTTTTCTACTATTGCTGTGGTTCACAAT
ACATCGGCTGCCCATGATCAAAAATCCCAGTGGAAGACGGTTCTTTTGCCTGGAGGACTTCCTATCCTTCTGGCGATGTTGGCTCTGCAATGGACGTCGG
TTTATCTGGAACGTAAAACTACTCTTCCATCGTTTCTTGTGGCATCAAGCTGGCTTCTAGTCGTCGTGCCAGTAGTCTGGTTACTCGTTCAAGCAAAGTG
CAACAGCAAAAGGGAGTTACGCTCGTTGAAACTGGAAAATAATGATGACCTTGAGCGTCAGCAAACTGGTGGGGAAGCTGCACGTATTGCGGCTGCGCGT
TTAACGCAAACCATCCTAGCTCTCACGCCAGGTTTCATATTGCTTAGCACGTCGTACGAAGTGATATTTTACGCAGCATTATGCAGCGGAGTCGTTAGCT
GGATGATGGTAGAAGCAAAGCAGACTACTATCGTAGGGGTTTCTGCGTCTCGTGAAGTGCAGAGGGCACTGTTGCTCTTACTGTTTGTCCAAGTTTCGTT
TTTCGGCACAAACAGTGTGGCTAGCTTGACAAGTTTCAAGATTCCAGCTACGCAGCGGTTCTTAACAGAATCCTCTCCCTTTGTTGCGCAGGCTCTTgtc
gtgctgaagctcgtgaTTCCATTCGTGATTGTTGGATGCGCTTTCCGTCTCATTCTACTGCTACCATCAGGAGCAGTCTCGATATTAGAGAAGGAGTTGC
GTGGCAAATCTCTTTGGGTCCCGAGGTACTTCCTTCTGGCAGCGTCACTGGCGGAGGTTCTGGTTGCACAGTTCCTCTTTCTTGTACGCAATGAAGGGAG
TTGGAGGCAGATGGGGAACTCCATCGCGGAATTCTGCATCGTCAATGCCCAAATCGTCCTTTTGCCGACACTGGTCATTCTCGCCTCTGCGCTCCTTCAC
GATTTAGAAACTACTTACAAAGGATAC