Description :
From Genome Similarity Track
Location :
Scaffold_173:14105- 15106
Sequence
1001 bases(100 bases per row)
TTTGTAACAGAGCGCTGCCTATGGCAAAGTCAGGTGCGTCACAGACGACGCTGAAAGGCCGATCAGGATCGGGCAAAGCCAGTATTGGCGCATGAAGGAT
ACTTTCCTTAACTGCTTGAAAAGCCTAATGCTCGGTGTTACCCCAACACCAATCCACATCCTTCTTAAGGAGATTGGATAATGGCCGAGCCATGTCTGCG
TAATTCACACTATACTTATGCAAGTTATTGGCAAGGCCAAGCCACTTACGTAGATCTGTCTGGTTCTTTGGAACCGGCCAATTGACTATGGCCCTTACCT
TAGCGGGGTCCGCTCGAAGGCCTCGCTTTCCAATGAAGCACTCCAGAAAGTAAATCTCTTCTGCACCAAAGATGCACTTAGATGCATTTGCATACAATTT
ATTTGTGCATGCACTCGAGCACCGCTCGTAAATGATCAATGTGATTATCCACATCAGTTCGACCGTTCGTTGCACAACTATGGACAAAGATATCATCAAA
GCACGTTTGTGCATAGCCTCGATGAGGTCTGAATAGTTGCGTCACCAGACGATTAAAAGTAGCCAGGGCATTTGACAGCCCTTGTTGCATAACGAGCCAC
TACCAGAGCATACCCTCGGGGTACTAATCGCTGTTAGCGGAATATCGCTTGCTCGCATGAGCAGCTGGTAATAACGATCGACTAAGTCGAGCGCACTGTA
CAATGTACATCCCACCATATTGTTCTGAAGAGCATTCTTTCTGGGGATTGGTGTCTGAGCCGGGATAGTGGCAGCATTGAGCTTATTATAAGTAGGCACA
ATACGCCACTTACCATTACGCTTTTTGACACAAGACGTAGGTGTGGAATGGGGCGACTTACTCTCCCGCCGCGTGCTTAGCACGAAAGAAATCGTCAATG
ACGTCACACTGTTCCTTAGGTAAAGGCTACTGCCGTGTTACGCAGTATTTAGTTCCTGGAACTAGGTCAATTTCATGACGTACACCTCTATCGGGAGGTA
A