Description :
From Genome Similarity Track
Location :
contig_18:141034- 142120
Transcript NameFunction/comments
g3708.t1hypothetical protein

Sequence
1086 bases(100 bases per row)
GCGGAGAAGGGCGAGAACCTGTCGGTGGGTCAGCGGCAGTTGCTGTGTATCGCCCGTGCGCTGATCCGAGATAGTAAGGTGATTGTGATGGATGAGGCGA
CGGCGAATGTGGACCAGGAGTCGGACAAGCTGATCCAGCAGACGATGAAGGAGAGTTTTGGTGGTGGTGCGAGCACGGTGCTGTGCATTGCTCACCGCAT
TGAGACGATCATGGACAGCGACAAGATTTTGGTGTTGGATGCTGGCGAGGTGGTGGAGTACGATACCCCTTCGGCCTTGTTGCACGTGAAGGGAGGAGTG
TTTCAGTCATTGGTGGAGTCTAGCAAAGCTGTAGGAAGGGTAGACTAATTGCACAGACATGGAGCCTAGTCCAGAGCTCACTGCTGTCAAAATGGTGCAT
GTTTCAGGGTCGTATTCAATCGGTCCGAACGTTTACGCGTACACTCATCATGGCTCACCTTGAGCCGGGGGCCGTCAATGCAGAGGTCTTTTGGAGGTCA
CTTCAGTCTTGAATTTACCGGCTGAAACTCAGGGCCTGCGTGACGTGAGTAGTGGTCATGCTGCCAGACGTCAAACCAGGCGAGCAGGATACTGCTACCA
GCGCCAATTACCATGAGGTCAAGACGCCTCGAGCCTCCTCGGCCTTGCCCTTCCCGGACGAGAGCAGACGGAATCCTTTGGACACTGCCAACCTGCTGTC
CATCGCGACGATCTGGTGGCTCCAGCCAATGCTGATTCGCGGCTACAAGTCCTCTCTAGACGAAGACAGAGTCTGGGACCTCCCGGAGGTGGACAAGGCC
CGCCCACTGCAGCAACGATTTGATGCCGCGTACGTGGGTGAAGCCAAGAAGAACAGTGCCAAGGCTGAGAAGAAGGGAGCCGCTGCAAAGCGCCCAAACG
TCAACTTTGCCTTGTGGCAGGCCACCAAGGACACATACGTGACGGCACTTGGGTGCTACCTGGTGAACTCCGTGCTGGTGCTCATCCAGCCCTTCCTGAT
CAAGGCCATCTTGCAGAATATGGAGGGGCAGGACAACATGTTCGGCATCTCTTCCGGCTACGGCCTGGCCGTGCTGTTGGGGTGCG