Description :
From Genome Similarity Track
Location :
scaffold_1714:1410- 2492
Transcript NameFunction/comments
g11644.t1hypothetical protein

Sequence
1082 bases(100 bases per row)
TCTGACCTGATCACTGGAGCCAATGTCCTGGCGCTGATGGCACGACAACCGTGGCTCGTGTTACAGAACCGCCCGGAGCCTCTCACCTTCGATCGCGATC
TACATCGCCGTGCTGGAACTCCTTTGGGGCAGATCGCGGCAGCTTACGCGGGGCTCGAGTCCAATCACCTTCAAGCCTACTGGGAGTCGACCCACTACCT
TGACATTACCCGCGCGATGCGGGCTGCCGATCCGGACCTCGATGGGTACCACCAGGCCCGCCGTCAACGGCGAATTCGAGTGGGGAATCGCTGGAGAAAG
CTCCTGGCCACGTTTCTCCCGATGATGCGGGGTCAGTGGGCTGATATCGACCTCTTGCTTGATCCGTTCTTCCTTCACCTGCCCACCACGCGAGATCGGG
TACATTGGTACCCAGGATCAGCCTCCTGAGCCGCCAACCGAGCCAATCCCACCTGAACCGTCCAGAACCGACCGATCTGATCACTGCTCTGGCTGAATGT
AATGAAGAAGACCCCTGGCGAAATCAGTACCGCGATCGTCAAGCAGACCACCCTTCTCGACGGATCGGGCGACTTTCGGACAAGTTCAACCCCCCTGCAG
CGCCTTCAGCCCCGTGAGTTCGCGATCCAGCTTTGTCCGAGTCGTATCGTCCAAGATCCCAGCTGATAGCCCTCGATTTCTGCCTCACGACTCAAGATTC
ACCGCCGTATCACAAGATCCGATCTCTTAGTCCGATTCCCACTGAACTCAAAAATCTAGCTTGTGATCCACGTTCTTCTCGCTTTTCCATAGTTCTCGCA
TCGTGATCTCGCTTCATCTCCATTTAATCATTCGAAATCACCTTCCACCGACCTCGATCACTCCTGTTTCACATGCATATACAAAATTCAAAGTCCTCTT
CTTGATCTGGATCGTCCTCCAGATCATCCCTCCAGATCTCGGTGAGACGACCACCTCGACTCACTGATCGCCCTTCTACACCTCTTCATGCGACTGCATC
ACGCCGAACCGGTTGCAATTCACGTGATCTCGCAGGAACGCACTCAGTATGGCACCACAGTTGAGATCTGCCTCGTCGATCC