Description :
From Genome Similarity Track
Location :
Scaffold_154:141- 6612
Transcript NameFunction/comments
Phymu_g5641conserved hypothetical protein
Phymu_g5642conserved hypothetical protein
Phymu_g5643conserved hypothetical protein
Phymu_g5644hypothetical protein PHYSODRAFT_475141

Sequence
6471 bases(100 bases per row)
TTCTGTGCACCACATACCCCTTTCAGAGTTGATACGCTCACCCCCATACAAACGCCCAGGCTCGAAAGGTGAGGATGCATCTGCTGCCAGTTCAGCTTGT
ACGTGCGCTCCCCCCAGCGCTCGCTCGCTTAATATGACGCGTGAATCTCATAGTTCTCCATGTGACCTACCTGTCCATACCGTTATTGTGTAGATCCACG
CCCTCTGTCGTCGTTAAATTATCCTTTAAAGAGCGCCAATGGACCCCGAGAACAGGAAGAAGTGTTCGGACGTCGCGGATCATTTCTTCAAGCTCGACAG
TTGCGGTGGGTAAATTCGTTCTGATTAATAACGTAATGACAATAcgctgaagctcctgctgtGATCTGCAGAGCCGTTCCGCGAGCGTGTCAACTGGGAG
GAATGGGGGCTGTACGATTATCTGCAGGTGGTCAAAGAGCCCATGGACCTAGGCACCATCCGCAGCAAACTGAGCAAGAACGAGTACAAGAAGCCAGTGG
AGTTTGCGCGTGACATGCGTCTGGTATGGAGTAACTGCAAGCTTTACAACCAGGACGGCTCCGACCTGTATCTGCTGGCGGACGAGCTCTCGAAGAAGTT
TGAGGACCGCGTTAAGGCCATGAAGCTCGATGTGGGTCCGGTACCCAAGGCTGACAAGAGTATCCCGTACGGCGAATTATTGAAGCGCAACGGTAATTAG
TAGTTtctaactttttttttactcTTTTGTGCTGCTAAACAGTGCCCCAAGTCTTGAAGAAAAGGTCCACTTCAGCCAGAACATCTACAAGGTTGACCCC
AAAGACTTAGGCGCGGTTGTacagcttctggaagagcAGTGCCCCAAGGCGCTCGATAAAAGCTCGCCAGACGAGCTGGATATTGTCGTCGACCTCATTG
ACAACAAAACGTTTCGTGACCTGGAGAAGtttgtgctggagaaggtgccAGAGGGTAGTCGCGAGCCAATTTCGACGCCCAAATCCTCCAAGAAGTCTCG
ACGGCCTCCCAGCAAGAAAACCAAAACGGATGCGTGAATGATGATGATCGTACAAGGTTAGTATTGGCTTGCGTTCACAAGTGCCTATGTCATGTATTTA
CACGCATCCAGACAACGCAGTTCGATCCACACCTTTCTACGGTTCGTTAGGGTATTTGTTCACCTCGTAATCCCTTACGCTTCGTTCTTTGTGTTTTATT
TGTTTGACCTACTATGGAATCTACTTTTTCTTTCGAAGCATAGCTGCAAGTCGCGTCTGCCGTTGGAACGTGGcctcgaagctcttcctcttttgCTTCT
GTGCAGGTTCGTCTGGTTCTTCAGTAGGAGGTACGCCAATCGTTGGCCCTCCCGGCAATCGGGTGAAGTCTAGTGGTGGCACAACCATCTTTTGTTGTGA
TACAGTAGATTCATCTGGATGGgctggaggaactgccgCTGAAAGCTGAGACCCCGCCTTGGCGCGAGTGGATTGCCACTGAGGAGGTATCGACTTTGGT
TCATTAGTCGTTTCCATTTTCGCACTGATGCCACGGGAGGCACTTTGAAGCGGAGCTATTGattgcagcttgagcagtgGAAGGTTAAACTTTGATGGGC
GTCGAACAGCTTTCCGGTCACGAGATGTTGATGGCCCGCGGACCGAGTCTGGTCGATTTTGAAGTGATCGCTtgtactcgagcagctcctccttatgcag
ctccatgagctccCTAATGGCCATCAACATGTGAGTGAGATCTTCGATagcagaagcaaaagctACTTGTCTTTACCCGAGTGAAGGTTCGTCCCCGCTG
GAGGCACTCCAGTTGTCACCATGGAGCTTCTTGCCTGCTTTCATGAGCCTTGTCCACTCCTGTTCATCACGACGACTTGTTTCCACCCGAGAGGTTACAA
TCTCTTCAAGTTCGTCGTGGTACCGTAGTTGATTTTCACGAGCGGCAAGCTGTTCTTTTAGCTTGCCAATGTATCGCCGGAGGTCCTCTTTTCTCTTCCc
aatctgctccagcacgccTGTGCTTGACTGTTGAACTTGTAGCGGAGGGTGATATCCTACAGCGCAGAAGAGTCATGTCTGGTGTTTTTTGCCTAGAAAT
GCACTTCACCCACATGATTCCCACGTACGTACGTACTTGTTCTCCTCTGTCGCTTTTGcatgtgctgctggaggaagcccACGATGAGCAGCCCCGCCAA
CACACAGCCGATGATCAAACCTGGCATGTTGATCGTTGCCCCCGCTGTCCCTCGAATATTCGGCATGTTGCTTATTCAACCACGAGCCTAATGTTGGTGC
AGTTCTTTCAAAAGGGAAGAAGGACATCTATCTACCGCCGGTAGACTACCGGCACACAGGAAAACTCATCCTGCCCTCAGCCTTATTTTTAGGCTAGATT
TGTTGTGCTTTCTTATAATGCGTATAGCATTTAAATTTAAAAGCAGAGTTCTGGCAGTTGTACCTTTCCATCGTCAGCCACATTTGCTGACGACAGACGG
CAGACGGCAGACGGCAGTCCAATGTATCCCCATCCAGCCATTGATGATCAACCAGACTCAGGGGGGGGaagactacatgtacagcgtAGTTCGGAGGCAA
GCGCATTTATTTGACATGTGCTTCCTAAAGTTGTACAAAATAAATAGGAATGGCGCCGTGTCAGCTCACACGTCTGCAACGAAcacatcttcatccacgg
CGAAGGTGGAAACGTCGAAGCTCAAGTTTGACGGTTGCTCCGACGGCATGGGCGCGACCCAGTAGTCACTGAAATCCAGGTTGTCCCAGCTCTCTCCGAC
GTCCACGGGGGACGTCTTGCCCTCAGGCAATGAGGCAAGCGCTTCCATTCCCGAAATCGATTCCAAGCTCTTGCTAACagcggcggcgtcgtcctGTAAG
ATacgatccagagcttcctcgtccaccgcTTCtgggagacgctgcagctcgacggggggcgtctgcagcactgaAGCAAGAGCCAGAggctgctcctcct
tcacgtGGAATCCGTTCCGGTCGTAGACGCCGTCtagcagcaccagatccTGAAGGAACCAACTGGTGAGCCCCGTggaagtggctgcagctgcagtcgc
gtTGTTCCTGCTGATCTCATTTGCCCGCTGCTTAGCACGCAACTCCTCTTTCATGGCTAGATGGGCGCTGAGTGGAGCACGACGCGTGCGCTGGCGTGGC
TTCTTGTGCGCACGCAGCCTCTTTCCTGAAGGCTCCGCGTCTGCAGACGCCTGTGTGCGGGCCTTGCGCTTCAGTTCGAGGCGGCGTTGGTTCTTGTTGG
CTTTCTGACGGTGGAAGTCGCAGAGATTGTGAAGTTCGCCGTTGCGTTTAAGTGCGCGCGTATTCCAGCACTTCTTGCTCGGGTAGCGGCACATACTCTC
CGGGTCGTGCACAGGCTGTTCCTGTGCGATAGCCGAAGCCTCAGGCGTCGTAGGAGACGTGGGGGTAGTGGGGGCGCCGGCGCGTGTGGCCATCATGTCG
AGCAGTGCGGCGAACGGGAGGCAAATGCGCGAATGGCCGGACTCGAGCCACGCACGTCCGTCCGGAAGATACCGGCGCCCACCTGCGCAAATCGGATCGG
ATGGCTACATGGGTGAATTGGATGAGCAGATGGAAGCGCATAAATGGGATCTCAGTTCCATAGTGAAAGCAAGTGAACGCCAGTCGAGTGTGGATTTTGG
CTTGAATTTCAAGGGATGGCTCAGAAAATCCGAGTGGGCAAATTCAAGTGAAGTGACTACCCGGTGCCACCTCCTTCGCGCTCTTGGAGCGCCAAAGACT
GCAGAGCGGAGCACCGGCCGGTGCATCTCTGCTCGGATGACTGGATTTGAGCGGGCAAAAGGCACTTCGATTTGGAGAGTCACGTGCGTGGTTACCAAAG
TTGTGCAAGCAATTTGTGACAGAAGTTGCTGGCAGTGATCAAAGGAAGCTGCGGAGTCGGGTAAACCAAGCCATGCCTCACATTTATGCCTGACTATGGA
CGCACGCGTGCGGCGTGTTGATGCCTGAAGTCCGCCCGCCACGGACCGTCACGGACGGGACAGTACCCCGAATCCACTCGACCGGAAATCCGAATTGTCA
CTGCAAGCAGCGAAATATATCttgccacttcaacgtgctaGTATAGCGCGGGCGTCTAAAGTATCCCCAGCACTGTGTGTGTAGTCAGTGAGCGGTGGAT
ATTTAATTCACGCGATGACAAGCACGAAACATGCCCAGTAGCGTGCGCGACAATTCGGCACTGGTGCTGTGGAGCAGGACATTAGTGGCGCAATTCCGAT
ACGCAGTGCGAACAGTATTACGCACTGCGATTCTTATGTGAAGGACGGACGACATTATTGGCTTTCGTATGGATTCAAAACGGAACTTTTGGTGGTCTCT
TCCACTGAGAAATTATTCACTTTATGACTTTTAGGTACTTTGCTATTTACTTacgttgacgaagatggtCATTCGGGCTTAAATGTTGGCGCGAGTGGCA
ATGGAGGGCCCTCGCCGCGTGTCCTGCCAGGAGCTTTGCAGTCCTTCTCCCGATCGCGCTACGGCAGTGGCAATAGGTGGCAGCACTCTGGACGGTGGCG
ACGGAATGGAAACAGGCTCCGCCTTGGGTGGGGTAAGCGGGTTACGGTGCATCCATCCATGAGAGTCAAAATTGGGCTCCATCTTTGCCATTGCCGCAGC
ACGAAGCATGGCACGAGGACTCCTCGGGTAAGACGCATGTACCCACGCGGTGAGTGGAAGGCGGTTGGACTCGCGCCAAGTGTCCACCTCATTGCTGTAC
GTTGGTGCGTTCCCCATTGCCACGAGCCCTGCcgctcgctgcagctctacGAGTGACGGAGTGGATCGCGGCGCACGGATGTACTGCGTGGTCAACGGCA
TGGAGCCCAGTTCCTGCTCGAGCTTAAGCTGGATGGAGTCGCGCATTCGCATACGACGCGCCAGGTCCGAGAATCCGTTGATGCCCGCGTGCAGCGGCAG
GTGGTTGCCCAAACCCAGGGCCTGGCCAGCTTTGCGCTTTTTAtccagacgacgctgatTACTGTTGGCCTTCTGGCGGTGCATCTCGCACAGGTTGTGA
CGCTCGCCGTTGCGTTTGATGGCGCGCAggttccagcagcgtttgcTGGCGTAGCGGCACTTGAGCGAGCtgaactcgtcgtccgtggTCTGCTGCATAT
TGGCTCTGGTACTGGAGAGAAGAGAGATAGAGAGAGAGTGGCTTATCCGGAAGAGGAcaaattgaagagtgagTGGTTTGCCTCTTACTCGCCTTCAAGG
TGCAGAATCTTAGCCTGAACTGAGATGTCGACTTTCGCGGTTTGCAGCGATTTAGTAGAGGCAGTAGATTTTTTCAAGACATACAAATGTCAAGTATTAT
GTCGACTTTATGGTGAGGAGACACCTGAGACTGTTGACTTAACGAAGCGGAATGTCGCTTTTTGGTGGAGAGgagacgttgctgctgatttATGGTCGGA
GTATTCAGTCGCGTCTTCGCCGGCTTGCGAGCTGCTCCGGACCGACATGAGAAGGTCTAGAGCTCAATGCTGCCAGATCGTCATGGGTCTGGGATATGTG
GCGCTGATTCCAGCCCGGACAGCCTACTACGATAGGCACTATAGGTGCCAATGACACGGCCGTCGGTGCCATCCTTTGGCCAACACGTAACCCAGGACTT
TAACCGTTTTGTAGCTCCTGATTTTTGTAGTGCGAATCAGTTCCGCTACCACCTTCAGCGAAGTCTTCACGACTGAAGCAATTCGGTGCCTGCACGATTG
TGCAGCGAACGTTTGGGAGACATGCAAGCAAACTCCCCGCTTCTCTCCTGGCTTGTGCAATGGTCGAGACTCGTCTGTGACTTTCAGCCGAAGATGCTGT
GAGAGAGCGACGAAAACTGGACTGCAGACGATCGCAGTGCCCCGAGCGGTCGAGATTTTCGAGAATACGCCCGGATCTGGGAGATATCCTTGACAAGAAT
CAGTGGGTTGCCAATGAATGTGGTGCGACGGTCTCCATGTGCGGCCAAACAACTCGCAGCACGTGTGTTGCTACTACAAGTGTCTATACTGGCGCCAGCG
TGGCTGCTTCGCCGAGCCTTTCCTCGCACTTAATTGATGGAGCTCTATCACGACTAAGTTCTGCGCTGACTCATGGGTGGTGTATGGTCGAGAGTGTTGA
AGCTACAGTCGGTCGCTGTCATCTTGGTGATCTCAGACAAGTTGAGCCCTGGACTCAACAGCCGCTACACATGCCAGATCAGCTTGTCTTGCGATTTCGT
CCAGCGGACTGTAACATCTTGGTGCTGTTGAAATGCCTAGTAAGTCTAACACACTCGTCCACTTTTGGAATAGTGACCAGGTAGGTCAAGTGTAGTTGCA
AGAGGAAGCCGGCATGATGCCTAGATGGTGGTCGCACGTCGTCATGTCGGCGAGCATCAAGTGGCGACACC