Description :
From Genome Similarity Track
Location :
Scaffold_867:141- 2867
Transcript NameFunction/comments
g14921.t1hypothetical protein

Sequence
2726 bases(100 bases per row)
CTTTGGTCATGATGTCCGCCAGCATCACAGAAGTCTCGCAATACTCGAGCTTCACTTCACCGCATTTCACTTCGTCGCGGATGTGGTGGTACTTGATGTC
GATGTGCTTGGCGCGGCCGTGGTTCACCGGGTTCTTGGTCATCTTGATGCACGACTGGTTGTCTTCACGGATCATGAGCTCGGGTCCGGTTTCGTTGGCA
GCCGCCAGAATCTCGCACAGCAGGCGATGGATCCACTTGCCTTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCTTCGCTCGTAGACAGCGACACAC
TTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATGAGCATGAACGTGTAGCCTGAAGTGGACTTGCGGTCCGCGAGGTCGCCGGCCCAGTCCGC
GTCCGAGTAGCCACGAAAGTCGATCTTGTCGCTCGGCTTGAAGCAGATGCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATGCGCTTGACCGCAACC
CAGTGTTCCTCTTGGGGGTTCTCCATGAAGCGCGACACATAGCCAACGGCGCACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAA
CAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAACCAGTCGCGTGCTCATGTCCACCGGACTCACCACAGCCTTGCATTCGTCCAT
GGCGAAGCGTTTCAGGATATCGTCCACGTAGCGACGCTGGCACATGGTCACGCTGCCGTCCGGGCCGTCCACCAGCTCCCAAGAACAAACGCGCACTTGC
CGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCCGTCTTCGTGCGCGAGATCAGCTCGGGCGAACTCCCGGTAATCAGCACGTCGTCCACGTACACCAG
CACGAGCACGCACTGACCGTCCACCACCTTGATGTAGAGGCACGGATCGAAGGCCGACACTTAGAAGCCGATAGAGCATATGAACTCGTCGAAGGTCTCG
TTCCACACGCGCGAAGCTTGCTTGAGACCGTAGATGGCCTTCACCAATTCCAGGCAGTCGAAGCCATCATCCAGTTCGACGCCTTCGGGAACCACGCAGA
ACACCACCTCCTTCATGACCCCGTACAGGAACGCTGTCACGACGTCGAGTTGGTCGAGAGGCCAGTCGAAGTACTTGGCGATCGCGATGATCATGCGCAG
CGTCACGTACTTGACCACGGGCGAGAACGTCTCCGTGTAGTCAATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATC
GAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTGCCGATGGCGCGCTGGCCGCTGGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCA
TCGACTTGAGCTCCGCGCGGATCGCCTTGCGCCAGTGCACTTGATCCGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATAGATCGGCTGCTGC
TTCCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGAGTCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGTCGGGTTCAGCTCGG
CGCGACGAGGATACATCCGGCGCACTTGCTTCTTCTAAGCCAGCTCGGTGGCGAACGGGGCGCGATCTTCTGGCAGTGTCGTCGTCGCCACTCGGTCGGC
TCTTGCGCTTCCCCGCCTGCTTGAAGCTCGTTTGGCGCGGTCCATCGTTGTCGTCCAGGTCCAGCGCGTCCAGGTCCAGCGCAGCATCATCGACGTCTTC
ATCCGAAGTATGCGTTGAAAGTCCAAAGGCCGACTCATCGAAGTTGACATCGCGACTGACAACCACCTGCTCCGCCTCGATGTCATAAAGTCGATACGCC
TTGGACACTTGTTCGTAGCCGAGGAACAACCCGGCGCGAGCCTTGGGGTCCCACTTGCGCCGCTTTTCCTTCGGCGTCAGGATGTACGTCTGGCATCCAA
ACACACGCATGTGCTTCACACTTGGCTTGGACTTGTACACAATCTCGAATGGAGTCTTGTGCTCCACCTTGGGTGACGGCAGGCGGTTCTTCACGTAGAT
GGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTCCAACTTGGCGTGATGCAGCATGCTGCGGCCGATCGTGACGATGGTCCGGATGGCGCGTTCTGCC
GTGCCGTTGGTCTGGTGCGCGTACGGACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGAGCTCC
GTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACTTGGCACGCAGGCAG
AACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCAGATGTCGAAGTGGA
GCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCATTTTCCCTTGCTGACAGCCGCGACACACGCTTGGTCCACT
CGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGATCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGCAGGTCGACC
GTCTTCCCACTGGTCGCCGCATTCAC