Description :
From Genome Similarity Track
Location :
Scaffold_2961:141- 2708
Sequence
2567 bases(100 bases per row)
CAAACGTCTCTCGGCTGCCGAAGGTCTTGCGCGCGTTAGGCCCTCTAAAGGCGGAAGGCACCAAAGCCCTCAAAAGAAAGCGTTACCGCCTCTAAATCTT
CCACTCCGCGAAGAGAAGGAGACTCGACGCCTCCTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGGT
GCCACTGTTGAGCCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCTGTGGCGGCACCCG
TCAGCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCT
TGTGGGCGGCCACACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCGGTGTGTGCTTCTC
GCGCCACACCGCATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGC
CCGAGAACTGTCCCACATGGAGTTCTTGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAGCTCCATGAAGA
TCAGCAGCTGTCCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCACGCG
GCTTCTAGCGCTCACGATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTT
CTGTTCCCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGG
AGCTGTCGCTTCCCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTAC
GAGTACGAGTACTCGGCGCCTCCCGAGAGCCACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGCCTCCGTCAACGTC
TCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGTCGCCTGGA
CCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGACCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAG
GCTTGTTGCCACGTCCGGAGCCGCTGCGCACACTCCCAGACGTACGCGTATGGTGCGTAACCCGGCGTACTCAGCTACTCGCTATGGCCCGGGTGCTGCT
ATGGAGCCTTCCGGCTAGCGTTCGGACGCCAACCCTGGCCTACGCAACGGAGTTGTGGGTGGCTGTCTCCGACGCCCTTTTTCGACGACTGTGAACGGCC
CTTCGTTTGGAGGAACTCGCGTTCAAGGGGGTTTGGCGAGTCAGCAACCCCCTGCGGGTACAAGTAACGGCTTAAGACGTCCGACATAGAACGTCGGGTG
CGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGCCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCG
ACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGTAACACTAAGTCACCAATCTCAAATATACTTAAGTTTCCTCTTCCTTGTTTGTCCGAGT
ACTCCTTTTGTTTATCTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACATGATCAGCTGTATCCATAAAGGATTCCACCTGTTCCGCAGCGAAACGG
CTCACATCGAGACTGGAGAGAAAAGGCTTCCGAGCCTCTCTCTCCTCTGAGAATTGAGAGAGATTGCCATGTTTTTCTGGGAGAGAGGGAGAGGCCTCTG
GGGGGGGGGCGGAGACCCTTGCAATGAAAAGCGGCTGAAACCGCGGGGAGCGCTGGCACGCGGCTTTTGGAGGCCCCAATCTCAAACACGGGGAGAGCGG
GTTTGCAACCACTTACGTGGGCACGTACGGGGTGCACCCGGAAAAACGTGGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTG
TCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGAC
AATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTCACAGTGACGGGAACTGGAGCAAGATGTACC
ATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGAAGCCCAAA