Description :
From Genome Similarity Track
Location :
Scaffold_2351:141- 1957
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2351-snap-gene-0.1Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_2351-snap-gene-0.2Conserved gene of unknown function

Sequence
1816 bases(100 bases per row)
CTCAAGCAGCAGAAGCTGTCGCTTCGCGCGAGCGCAGCCGCCGTCGGACAGTCCAAGACGGCTGTCTCCAACTTCCTAAAGGACCCCGACGCCTATAGCG
ACAAGAAGAGAAAGGGGAAGGTGTGCAAGCTCTCCGAGCGCTGCACAAGAAGACCTCGTACCATACCATCACCATTCCGTCAGCCATCTTCATTCCGTCA
CATTCCGTCAGGCTGGCAATTTGTGTAGCACACACAAAATGCGATTGATTCAACCGCTTAAAACACCACACTCACTTTTCCGCCACTCAATTTTCCCACA
TACAAAAACAAAGTGAGAACACACAAATCAGTGCCGACAGAGCTCACTCGCTCTCATTCGGCATTTTTCTCCAAAAGCACGCAAGCCGACCTCCCTCCAC
ACACACTGACGGCGCAGCTCACTGGCGCGAGCGCAGGGCTTCCTGCCCTGCTGTTGCTGGTTCGAATCCAGCCGCCGTCATTCAAGAATGTTCGTACGCA
TGTGTATATATTGTGTGTGTGCATTGGCGAATTGTGCGAGCAGCAATGCGGTTAACCTTGTTGTACCCGCAAGGGCGTTAAACTTGGTGTGCGGAGCTGC
GAATGCGATTTGCTGCAGTGTGCGTGTGTGCTTGTGTGTGCGTAAGCTATGAATATATTCAAATGGATGAGCCGATCACTGTTGTCTTTCCGCATTACGT
CGAGTTGTGTGGGGCGGTCGTAAGTATGTTTTGCGTGGCGGCTGGTGCGGGGTCTGCTATGTTTTCTGTTTGCAGCAACAGCCGATGCTCAGCGGTACGA
GAGTTCAAGAGCCCAGCACGGTGAAGCTTCCTCATCTCGCGCAGCACCGTTCCTGCCCCCTTCGCCTTGATCCCGCTATCGCGCAAGAGCTCGAGAAGAA
CAGCTTCAGCAGCAAGCCCGTACGCGTGGACGCAGTCTTTGAAGCTTGGCGACGCTGGGTCGAGCTGGAAGCCGGTCGGAAGAAAGAGCTTGAGGTACAC
CACGATGAGCTTGGAGTCTGATCGCTTCTGACGTTCGCTTGAGTCCCACACGGACGGCACCTTCGTGTACCATTCGTACCAGACAGTAGAAAGGCTGGTC
GCGGCCGTTTCCTTCCTGCGTTTTGCTTGTGGTTCCTTAGGCTCGCGCTCGTTCGGCTCAGTCTCTATGGCGCTGGTTGCGAGCTGCACAAGGGTGTGCG
AGTCAGGAAGGCAAAGGAGAGCTGCTTCACAGACGCGAAGCCGAGCCGACAGCTTTCGATTGAGCTCGATGAGCTGCTGGACCACAGCAGCATCGTGGTG
AGCTTGCTGTTCTCGCGTCATATCCGCCGCGCGTGAGCCATCTGCTGTCGCTGTGTTGCTTGTAGAGCCGTCGCCGCGAAGAGCCATCGACCACGCGAGC
ATTTCGCCCATCGGAATCCCTGCTTCGCCAGCGCAGCCTTCCAGCTTGCGAACGATTGGTGCGTGCACGTTCAGCTCCTTCGCCAGCGGGAAATACATCA
CCAGGTACGCGGTCAAGACGTAGAGCATCTTCACCCCAACGTTTAGCCGTTCGTCAGCATGCCCAGTGCACGAGCCGAAGAGCAGAGACTGCAGCGTGGA
CAGCTTCGCTTGAGTTGTGTGGTCGAGCGCCGCAACGTCTGCGATTGGAGGTATCGCGTCTGAAGCCTAGCCGCTCAGCACCCGCGCGACCTTCCTGTCT
TCCCGCGGCGTATTGAAGACATACGCGAAGCCTTTGTTTGTCGTGCTGAGGTTCCAAGCCCCGCGATCGAAGATCCACTGCGGCGCAAGCTTCTCGTCGC
TGTTCGCGTGCTGCGC