Description :
From Genome Similarity Track
Location :
Scaffold_2522:141- 1830
Sequence
1689 bases(100 bases per row)
CCACTTGTTCCAAGTGGATCTGCCCAGCTGCCGAAACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCT
TGATCTCTAATGAGGGCCGACTTTGACTTTGCTGATCCATGTTCTCGCTCGGTTCTCATCTTGATCCTTTGCCCGTGAACTCCTTTCAGATCCGATATGG
CTGAGATCCGTATCCTCTAGATCATGGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTATCGCTGCTGACGAAGTGGGATGGGCCATCCAGATCATCT
GGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGCTC
TCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCAAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTTGCCGTCTGGTCCAC
TGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTC
AGATCACGCGTAGAGCGTACTGAATCCCGAGTCTTCACGCTTACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGG
CTCCTAAAGTCATGCGTCGGGGCTCGGACGACGTGTCGGACCCATCCTCAGCTGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGA
CACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGACAAAGAGGTCCCGTGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAG
ATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAATTTGTTCGCCGTTTTCGTTGGTG
CTCTCACCGGTTCGTTCCCTTGGATCGTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGAT
ACCCAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGT
TTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACT
TTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGGTTTTCTTCTAGATCCGGAT
CCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCTGACGACGC
CTCTTCCCCTGGCTCAATCTTTACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAG
CGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACCGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCG