Description :
From Genome Similarity Track
Location :
scaffold_681:14099- 15687
Transcript NameFunction/comments
Pl_103004methionine aminopeptidase, putative

Sequence
1588 bases(100 bases per row)
GCTCGGCATCACACATCTTGACGTCCTCTTCTTCTTCTGGGGTTGCAGCGGCCGCTTCTTGCTCCTCTAGTTTCGCCATTGCGCTTGAGGCTTGGACGGA
GACTTGGATAGTGAGTTGGATGTCGGCTCAGATGCAGAGTAACGATTGGTTATGGTTTCAAGAGCGTAACCCAGCGTAACCGTTTACACTCGTTTTTATG
CGACATGACAATATTTAGTGTGGTGTACATCACCAACTCCAGGTACATAAATGGATGTAAATCACACCTTTCTAATGTAGATTTTCAAATCTCCGCCTAC
TGTAGAATCCTTGATCAAGAAATCTTACAATGGTGTGCATCGAGGTGTGCCAATGTGTTGGAGGTCTTCCTTGAGATCTAGAGCTTTCAGCCTATGAGTA
TCAGCCTTTCGACCCTTTTAGAAGCTCTTCACAACGAAAACAACCAACATTAAAGTGTTCAAGTCTTTTCGTCGTGACAACATCACAAAACATATCCATG
AACAGCATCATGTAAAATGGGCGAGAGTTTCAGCTCTTCTTATGTAAACAAGAGCTTTTTTATTAAGTCTTGAGTTCTAGACACCAATTGGTCGGGGCAA
TCTAGCGTGCAATTGCGAAACCCGGTCAATATCGTCAAGCAAATTAGAGTCACTTTGCTTTACTATCAGCGAGTACGAATTCGCTCTAGGCGACACTGCT
TTCGCTATAGAGTTTGATGAGGGAGAGTTTTCAACTGGAATGGTGACTGATGATTGTATTGAGAAGGAGGAATTTCTTCTACAAACCATTGGTCGTCAAC
ACTGTGTCAAGCTTTCGGGTTTTGCACGATTTTTTGCTATCTTCAGCGAAAGTTACGGAGGCATCAAACTAGGAGACCGAACGAACGCTTAATTGGTCCC
TACACTCGCTCTCTGGCGGCGATTTGAGAGAGATAAGGAAGACGGTCGATCCGGGGTAAATGGCTGAACGGCTTAGTTTTGCACCGCTATACTCTCTTGA
TTTCTACAATGGACTGGGATAAATGGATCGATGTCATTCAATCCAAGGTATAGTCGATGGAATTGGAGAGTTTATAAGGAGTATTTAATCGATTAAGGTT
GAGATGATTTGCAACCATACCACAAAAAGACCTTTGACGGCCCTGGGTAGCATCACAAGTGAAAGTTCTGACTTTGGCTAGATAACACACCAATAGGCTC
AATGGTACCTAGAAGAACTCGCAATCAGCACATACCGGGTACCCGCACCCACTCGAAATTGTTTTCTGGCCGATTCCGGGTACCCGCACCCTCGTGGATA
AGAGCGGCGTTCGTCACCAAGTGGAGATGCGAGGCAAACGCACGATGGAGGGTATTTACTTCAAGGCAAAGAACGTCGGACGAGTGTTTGAAAGCGAAAA
TTTCCTAGACACGATCCAGAATCCGCGTACGTCGTATTGCGAATGTGTCGACTTCGTTTGGTTTGCCTTACCATATCCAGACTTTCCAAGAAATTTGCAA
AGCAACTCAAATCAAGGACATCCCCGCGCCAGTGACACCTCTCTACAAGAACACGACCATCACTCTCCACAAGAACAGAAGCGAGCGT