Description :
From Genome Similarity Track
Location :
contig_222:14098- 15717
Transcript NameFunction/comments
g12163.t1transmembrane protein

Sequence
1619 bases(100 bases per row)
CCAAGGGCAACAACTACCACGAAGTGAAGACTCCTGACATCGGAGAGCTCGAGGATGGAGCCATTCGCCCGGGAGGCCCACCCGACCTGTACAGCTGGCG
CAACATCGGTCTCATGGCGCAGTACGCTGCCGTCGGCGTGGTCTACGGCACCATGTACAGCGCCATTTACCCGTTCCTGACCAACTACCTACGCATGTCG
GGAAACGAAACGACGTCCGCGAGCGTCTTGATCACGTTGCCGTACACTCTCAAGGTTTCATCGGCATTGTCACGGATTGCTACCCGATCTTCGGCTACCG
ACGTCGTCCATACATGCTCATCGGCTGGGCCGTGTGCTTCGTATCCCTGGTCGTCATGACCGCCTTGCCTATTGGAGACCCGTACTACCCGGACTCCAGT
TGGGCAGCCCTAACGAGTCTCACGGCCGAGCAAACGGCGCAGCTGAACACGGACGCACAGCACTCCGGGGTCAAGTATATCTTCCTCATGGTCATCGCCA
ACTTGGGCAGCGTCGTGGCATTCACGGCTTCGGACGGTATTCTCGTGGAGCTCGCCCAGCGCGAGCCTCTGAAAACGCGTGGCACGCTGCAGACCGTAGT
GTACGCGGTGCAGTACAGCTTCCAGATCATCTCGTCAGCGATGATCGGCTTTGGACTCAACAGCGGTGACTACGGCGGCACGTTCTCCGGCTCCATGGGC
GTCAACGCTGTCATGGGGTGTGCGCAGCTTTTTCGCTGGTCGTGATGCCCTTCTCGTGGTTCTGCATCACTGAAGAAAAGACTCGACGTTCGGCTCGGAA
GTACCTCTACGCGCTGTACGAGCTCATCCAGCAGCGCGTGGTGTACCAGATCGTCATCTTCCGCTTTTGCCGGAACGTCTTCTCGTACGTGAGCGTGACG
GCGTCAAGCTTGGTCCAAAGTTACTGGTTGACCGTGAGTCCTGTGAACAGCAGCGTCGCAAGCATCATCGGTCTGCTTGCGTCGGCCGGCTCGCTGTACC
TGACGAAACAGTTCGGACTCAACTGGAACTGGAGATACATGATCGCGATCTCACAGATTGCGGTGATTGTTATCGACGCCTTCCCTACCTTCTTCACCAT
TTGGGACGTATACCGCAGTCAGTGGTTCTGGCTTGGTGTTCCGCTCGTCGAGAACTTCCCAAGCGCAGTGGGGACGATCGTCGCCACGTTCGCCGTGCTG
GAGATCATCGAGGAGGCAATGAGGCCACGGTCTACGGTCTTATTACTGCTGTCTCCACTTTGGCGTCTCCGTTCGCCAGTGTTATCACCAAGAGCATCGA
CGGCCACTTCGACGTAGAAACCGACTACATCCGACTGGACAACTCGTACGTGCGCTGGCAAGTGACGTACACCTACTTGATTGCCTACGCCTTCAAGCTC
TGCTCGCTCGTGTTCCTCGTGCTGCTACCAAAGCAGAAGGTTGAGACGCAGGAGCTCAAGCGCACCGGGGCAAGAACAAATGGATTGGTATCGGCACGAT
CATCGTCGTCGCCTTTTCGCTCGTCTGGTCCGTTATGACCAACCTCATGACCATGTTTGATAGCACGTCCTGCCTCCGCATCGCCGGTGGATCAGGATGC
TAAGCTAGATAAACGAAAA