Description :
From Genome Similarity Track
Location :
Scaffold_189:14097- 15540
Transcript NameFunction/comments
Phyag_g3267hypothetical protein

Sequence
1443 bases(100 bases per row)
GTACCAAGAGTCTCCTGTCTACAACAACCAGAACACTTTGCGGTCGTATCAGCTTGAAGGCCTCAACTGGATGACGTTTTGCTGGTACAACCGTCGCAAT
TGCATCTTGGCTGATGAAATGGGTTTGGGCAAGACTGTTCAAGCGACGTCTATCCTCGAACATTTGCGTCAGCGGGAGTTTATTCGCGGCCCGTTCTTGG
TTGTGGCTCCACTTGCGACTCTGGGTAACTGGAAGCGAGAAATCGAGACGTGGACGTCAATGAATTGTGTCGTGTATCACGATTCAGAAGGAGGTTCTGA
TATCCGTGCGTTCATTCGGGAGCAAGAGTTTCACTTTGCGAGTGAAGCACATCGCAGGCGCGGAATTTACAAGTTTAACGTACTGGTCACTTCGTACCAG
ACCCTGATGATGGATGCAGAGTTCCTGGAAACGATTCATTGGCGGTATATCGTTATCGACGAGGCTCATAAGTTGAAGAACCGCGAGGCAAAGCTGCTTC
AAGTGCTCCATGGGTTTCAATGGGATTCATGCCTGCTGATGACGGGTACTCCGCTCCAGAACGGCGTGTTCGAGCTTTGGTGTCTGTTAAACTTCATTGA
GCCCGAAAAATTCCCGAGCCAGCAAGAGTTTTACGATGAGTTTGGTGATCTGAATACGGCGGAACAGGTTGCTCAGCTACATGAGCAGTTGAGACCGTAC
ATGTTGCGGCGAGtgaaggaggacgtggaaAAGAGCATTCCGCCGAAAGAAGAGACGATCGTTGATGTGGAACTTACTACGATGCAGAAGAAATATTACC
GTGCTATCTTCGAGCGCAACCGCCAGTTCTTGAACATGGGCGCATCTGGCACCGTCGCCAATTTGGTCAACGTGGAAATGGAACTacgcaagtgctgcaa
ccATCCATTCTTGATTCGCGGCGTAGAGGATAAAGAATGTTCCGGTTTCGATGAGCAACTGCGAATGAAGGTCTTGATTCAAGCAAGTGGCAAAACGGTG
CTTCTCGACAAACTGCTCACCAAGTTCCGCcaagaaaagaagaaggtgcttATCTTTTCGCAATTCAAGATCATGCTGGACATTATCGAAGACATGTGTC
AGCTACGAGGATACAGCATGGAGCGTCTGGATGGCTCTGTCCGCGGAAATTCGCGCCAGGCGGCTATCGATCGTTTCAATAACCCTGAATCGGACACGTT
CGCGTTCCTTCTGAGCACCCGCGCTGGTGGTGTGGGCATTAACCTGATTGCTGCTTCTGTAGTGATCTTGTTCGATAGCGACTGGAACCCTCAAAATGAC
CTGCAAGCTGTTGCGCGTTGCCACCGTATCGGTCAAACGCAGTCTGTGAACATCTATCGTTTGGTGACAAAAAAGACCTATGAGGCCCAAATGTTTGAGA
TtgcgtcgaagaagctcggAATGCACCACGCCGTGTTCGAGAC