Description :
From Genome Similarity Track
Location :
Scaffold_385:14093- 15500
Transcript NameFunction/comments
g17386.t1POM63724.1 ATP-binding cassette (ABC) Superfamily [Phytophthora palmivora var. palmivora
g17387.t1hypothetical protein

Sequence
1407 bases(100 bases per row)
CGTGCGTCGTCGTACGACGTCGACTGTCTTCGCGACGAGGTGGCTCACCTCCGTTCTGAGATCCAGAACCGGCCGAGCTATCCGGGCTATCGGGAGCCGC
AGTCCTATGCGTACTCCCAGCCGTACTACGGTTCCTACCCGTACGGCGGGGCGTCTTCGAGGTCACAGGCTTACGCCTACGACCAGTCCCCTGCGCCGGC
TTCCGCGTGGCGGTCGCCACAGCGGGAGGCGGGCGCTCGGTTCGAGGTGGTGAACTCGCCACCTCAGAATCCCCTTTCGCTTCCTGCGGGGGGTCAGAAG
CCTGAGGGTCGTGGTAGCGCTTCAGACGACCCACATAAAACGTCGGGTGGGTCGTCATCGACTTAGGCAAGTCGATCGTGTAGGCGGAGCCATGCCTGCT
CAGGACCTCAAAGGGTCCGATAAACCTGTGCTTCAGCTTATTGCTGAGCACGGAACTGGCCGAGTTTAGTGGTAGGTTCCTAGTGTCGAGTAGGACTAAC
TCGCCCACTTTAAACACGTTTAAGTTTCCTCTTCCATGTCGGTCAGAGTACTCCTTTTGTTTATCTTGGGCGGCGGCCATTGTGTCACGCACCCGGCTTA
TCACATTAAGCCTGTTGTCGACAAAAGTCGACAACTGCTTCTTTAGGGAAGCCGGTGTCACGTCTGACACCTGGGAGGAAAGAGCTTTCCGAGCCTCTCC
CCCACTTACGACCGAAGCCGCGGTGTCACCACGGAGAGTGAGTGGCACCAGGGGGTTTCGGAGCCCGTTGAGGTAGAACGGGGAGAACCCCGTGGACGCG
TGTACCGCGTTGTTGAGTGCAAACTCAACCATCGGCAAACTGGCCGACCATGTGCCGGGAGATTCGGCACAGACACTGCGTAGAGTGTCTTCGAGGACGC
GATTGACGCGCTCCGTCTGGCCGTCCGTCTGCGGGTGGTCGGCCGTGGACATGAGCAGCCGTGTTCCAAGCAATTGGAACAGCGTTTTCCAAAACGCAGA
CGTGAACCGTGGGTCACGGTCAGAGACAATAGTCTCAGGGAGGCCATGATAGCGGAAGACGCCATCCAGGAACAGCCGTGCAGTCTGTTCACCGGTGACT
GAGTCAGCCACCGGAGCAAGGTGTACCATCTTGCTCAAGCGGCAGACAAACACCAGGACGCCGGTGTTGCCCTGGGCATCAGCCGGCAGTCCGAAGACGA
AGTCAAGACTCATCGACTTCCAGCAGTCTTCCGGGACTGGCAGGCTCTGCAAAGGAGCCGAGGCATGACCAGCAGGTTTCACTCGCTGGCATGTCTCGCA
GGTCCTTACATACGTGGCGACCCACTTGTACATGTGGGCCCACCAGAAGACCTGGGAGACTGACAAGAAGGTCTTTTCGCGGCCAAGGTGGCCGCTGGAA
GGCACAT