Description :
From Genome Similarity Track
Location :
contig_72:140929- 141998
Sequence
1069 bases(100 bases per row)
CAGGGGAAAAAGCTCGTGGTAGGCAGCCCGTTGAAGCGATCGCCATGGGGACAGAACGCCAACCGTCCACGGACACCGGCGTGCCTCCACCTGTCGTTCC
CGATCCGGAGCCTGTGACCCGGCCGCGTGGCGGAGTGAAGCCCCGACTTCAAGCGAGGCGGCGGATTCCGCTCGTCATCACCGTTTGTCCGTTTCCATCG
TTCTCGTCGGCACCGCCGAACCTTGGCGTGATATTCTCGTCACGCAGCAGTCAGCAATGCACGTAGCAAACGTCATGATTCCCCGCGAGCATCAGTCGCC
ACGAAAACGTTCTGGCGCGACGAGTCGCAGCGCCTGCTTCAGTCGTAGCGTTGTTTCTGCTGGCATTCATCACCGTAAAATGTATCGATATGCATCCTTT
TTTTGTAATATGTGTGAAGCAGTGCGGCCAGGAAGGCTCAATGCCGGTGTACCAGATCGCATTGACCGGTTGCCAGGAGACCCAGCTGCTTAAGCAACTC
CGCACGTGTGCGGAATGCCGGTATGGACATGTATTTCCTGGTATCGGTCCAACTCTGAAAGCGGAGAGCTGCAGATAGATCTCCGAACCAAATCTCGCGA
CTAGCGCACTACAATAGCATGTCAACTTCAACATGAGCATGTAGACAGCGTTGTGATCCCGTGCTGTTGACTCGGTTGTTTAATTGTTTAACGACGGCGC
AGACCAGCGTCCGAGATGTGGTAGACAGCTGCGGTACATCGAGTAGGACGAAGTCTTTGCCGACTCGTTGAATACTTTAGCGTCGGACCTCTTCCAACGA
GCCAAGCGGTGTGTGCTAAGTAGACCTGGCTCACTTAGTACACTCCGGTGTTTAGTATACGATTGATGTTTGTGTGTCATTGTTTAGCTCCCATCGAGAA
CTTGTCCCTACGACGTTGCTGACACTTGGGAGAACAACCACGCTGGAAAATGAGGTCTCGCTTTGTCATGCAACCAGGTTTGCAGATTCGCCACAGCGAC
TGCAGTATAAGAGGTGCCGTTAACGATACAATCACTGTGAGCACAAGCTAAGCTATTTCGGTTTGGAAC