Description :
From Genome Similarity Track
Location :
Scaffold_93:140927- 146276
Sequence
5349 bases(100 bases per row)
CAATGGTGCTGATGAAGTTCAAGTCAAAGGTCAACCGACAGATGATTACCAGCAAACCACCTGGTACTCCTGATCGAGACGACTTAAATAAACGATAGGT
CCGACCTGGGCGGAAGAAGCGTGGTACAGTCCGCTATGAAGACGAGTTTAATGGGATGCGTCGTATAGAATCCAACGATAGTGACTTAGAAGACGAGTTC
GAAGGTCTTCACTGATACTCAACTGTATTGAGCGATGAGAAGAAGACAACGTACGATGGTATCATGGAGTCTGATTTGAAGATTCAGTGGAAAGCGGCAA
TGGATGCTGAAATACAATCACTGTCGCAGCGTAAGACATGGGAACTGGTCGACCTACCATCAGGCAAGAAGATGATTGGCAGCAGATGGTTGTTTAAGGT
GAAACTGAATGCAGACGGCAGCATAAACAAGTTCACGGCGCATCTGGTGGCTCAAGGCTTTACAAAACAGTTCAGAGTCGATTTCAATGAAATGTTTGCG
CCGGTTGCAAAGCAATCGACTCTTCGAACCGTCTTGTCGATTGCAGCTAGTAAAAATTTGGATGCAGAACAGTTTGATGTCGATACAGCTTTTCTTTGTT
TGCACCAATCGAAGATGAGCTGTATATTAAGCAATCAGACGGCTATGAAGATAAGACACACTCAAAAAAGGTCTGCCGACTGCTCAATAGCCTATACGGA
ACACAACAAGCCGCACATCAGTGGAATTAAACTCTTAACGACTTTTTTTACCCATGATTTAGTGTGATCCGATGCAGACCCGTGTTTGCATACACGCATG
AGTAGCAGCGAGTATTCAGCGGTCGTGGTTTACGTTGAAGATTTGAGCATTTTAATCAAGACACAAGATGGCGTGCGCAACATAATCAAGAATCTCAAGA
CTGCGTTCACCATTAAGGAGCTCGGCGAGCCACGTTTTATTCTTGGCATTGAGGTAACTCGTGACTGGACCAATCGCACCCTTACATTGTCGCAACGCGG
GTGCATCCAGCAGATTGGTGAAAGGTTCCGGATGACTAATGCAAAAAAAGCCCAGTTACATACTGGCCGACGCAAATGCGCGCTTAACACGTGCTACTGA
AGACGTCCGCTGCATCACGAATGTACCGTACGTAGAGCTGGTCGGGTGCCTCATGTATATCGTTACTTGTACAAGACCCGATATCACGGATGTAGTATGC
AGTGTGGCCAAGTACTGCGAGTACCACACGAGCGAACACTGGTCAGAGGCAAAGCGCATTCATAAGTACTTATTAACGACGCAAGATCTAGCGCTTGTAT
ATGATGAGAATCTGGCGAGCGAGTTGATATAATTTGCGGATGCTAGTTGGGCTTCGGATGGAGACACACGGCGTTCGACAACTGGCTTTGTCTTTATACT
CAACGGTGCAGCGATCGCAACGACAACCGACGGTGGCAGGTTCGAGCACAGAAGCAGATTACATGAGCCTGTACTCTGCCACTCAAGAGATGATATTGCT
AAGGCGTTTGATCAAGGATCTGTGTATTTTAACCGATGTACCGACGACAGTGTATCAGGACAACCAAGGAGTAACCGCGCTAGCACGGAATCCAGTGTGA
CTCGCGAACGAAACACGTCGACACGAACTACCATTTCTCGAGAGAACGTGCTACGTGTCAAGTACACTCCAACGGCAGACATCGTTGCCGATGCATTGAC
AAAGAGTGTACCGCGCCCAAAGCTCGAGAATTTTAAGCAACAAGTTGGATTAAATATCCTCAATCTCTTATCGTTTGAGGGAGAGTGTCGAAGGTAATCG
AGTACGAAATCAAGGGCGCAAATCGACTGGCTACACACTGTTATAAGTAACGTTCAGTCACGGTTCAACTGGCTGAAGCAATATGCATCAACGGTATAGT
CATGGCATATGTACACAAGGACCGTTTAGCGTCTGTACGATGTATTTGTATAGTGAGTGGACATGAAGAACAAAAGAGCTCCAACAACTAGTGGGAGCAT
TTATAAACCACTCAATACATTTCTACTTTTACATTTACCACTTCTGCAACAGTGCATCACAAGCGTCAACTTCAAATAACAACAAAAACGAGGTAAGATT
CGTCAAGTGAGGCTCGTCGATTTAAGACTCGTCGAGTGGAGACTTGTTGAGTTAAGGCTCGTTGAGTTAAGGTTGTTCGATCTAAAGGCTCAGCAAGCGT
GCTAGAAGCTCGACGGTTTATTTTACAAGGTAACTGTACAGGAGAATCATCAGGATGGAAGAAGGCCACACAATAGGCTCTCTCTCAGTTGAAACGGGGT
ATAAATAAATACAGGGAAGATTTTTTCAAGTCCTATTAAAGCGTATACACTTCTGATGAGTCACTGCGTGGTTTGGATTTTGCCTGATTTCGGACCTCGA
GAGGCATAGCTTGCAGAGATTTCGACTGGAAGCGCCAAGTATTCAAGCTAACCCGGGGTGGGCATTACTCGCTTCTAGCAAAATAAAGAGCCTCCTCGAC
GATGAACCGGTCAACCAATAGATAGTATTGCTAATGCTTGCCTAGTGACAAGTCGGTCAACCTAATAGATGGTACTGCCAAAGACTTATCGATAGATGAA
CCGGTGATTCTTTAACCTAGGACACCGTAAGTCATCTAGTCGGGCGTGTACTACGCCCGGTGACCAGTAAATGCGCGAAACCACCGACATCCACCCATTA
GTGTGAAGTCACAGTATTTTTTTTTAAAAAGTGACTGAAGCTGCTGTGCTTAGGCAAGCGTCTGAAAGTGAGAGCGGTTGCGGGTACTCAGTGAGGGCAA
AATCTGCAACAGAATCTGAAAAGGCGGACCCCGATGGAATTTAACCCGACGTACTAGCCCAACTGCGCCGAATTAATCGGTAATTGTCGTGCGTTGATAC
TGTATTACCACGGATTTAAGTAAGTACTATCCCACACTACCGTCACGTGTCTCTGAATCAAATATACTTGGAAGGTATACCCAATAGCCACGACTAAATT
GGTATATGTAAAGTGAGCAGGCGCGTTGTGGACTCATAATTTTCGTGAGTTTTGCCGTGCGACAAAATAGCGCGCCTTAATTTTTTAATTCTCTGCTTGT
CTTTCCACAGTTCGAGAAGGAGCATTTTTGTCGATGTCGCGTGACATTCGTATCATGGGAGAAATGATGGCAACTATCTTCCTTCTAAATACAATTTGAA
TAGGTCAAGCATCGCCACACGCACTACACAAGTATGCGTACACGCGCAAAATCCTGGGGGATAGCAAGCACCACGATTACCAAGAACCAATCGGCTGGAG
ATTCTACTTCGGCAACAACCATCGGTAATAGGTCCAAATCCGGCTTTTCCTTCCACGGAAGTGTTGTAATTAGTATCTAGATCTAATGTCAGGTGTTAAC
TTATCCATTGTCTCTACCCTGTCCTGAAGTGTCCTTATGGCTGCATGTCGAGAATTCGGCTGGTCTGGAGAGGCGCTGCCGATTGAGCCAGCGGCTTGAG
AGACAACCGGTGAATATGCGGTAGGGTTTGGTGCAGATATGTACATATTCTCACCCACAATTCCGCTCTAAGAATGCATGCTCTGTCACGTCTATGGATT
TTGGAGGGGGCGGGGAAGGGTCGCGAGCTGGCGCCAAGCGTCTACAGTTCTAGCGCTATGTCTAAGTGGGGAGGAGTACAATCCCACGCGATTTACCGTA
ATTTGTAAATTGTTAAGATGCTAGGTCACAAATTTGGAAGTATTGTAGAAATGTTGCTGCAGTTGTAATCTCCTGACTTTTTGTCAGTTCCCCAAATGTA
TATGTCGGCTACATTTTACTTTGTTTTCAGGTATTTAAGGCCAAAGGAATTCTTAAGTTTCGTGTTCTGCTGCAGCCGCAAACATTTTAGAGGACAGACG
AGTACCGGTTGTAGTGGAGAGCAAGTTGATTAATTATCTATCCTTTTGCATATACTCCGAAAACAGAATATGGATTGAGAGTCTTTCGTATTATCCTTGC
ATCTAAGCATACCTTATTGAATTAGCTTGCTTGACATATCATGTAAAACTTAAGTCTTATATGGAGGATCTTGATCGCTAATCGACAAAATTCTAGAGTA
AATCAATTTTTGATCATTCTTTCATCTGTACCCATCGTTTTTCATCTAATTATACGTAATGAAAACGACCTACGCATAAATCTCAAGTCAAATGTGTGTG
GTTAAGTTATCAGTCATAGGGTCAAGCTCTCATTGTCAGGAATCTCAAGTAAACGAAGTATTATATCTCTTGGCATAATCGTTACAGAAAATTTGCTCTA
TGTCTTGAAAGGTGCAGCAGGTATCTCCCACTCTTTTAGCTCGACATCAGGCCAAAATACGAATACGAGCTTCCCCTTTCCCCAGTTATTATTTTTTGAG
AAACTATATATACTACCTGGAACTCAAGGTTGGGTTACTTAATAAATGGTTCAGTAAATTAATCTTGAGGCAGCTTATCTTCAAATCAAGCTTGCTTTTA
ACTCGGCAAAATGATCCTCCATAGACACATACATAATCGTATTTTTTATTGATTGCATCAGCAACTTTGTTGATCTTCTTTACGTATCAAATAGCAATGT
CGTAGTTGTCGACATCTGTGCAGATTGGAGCTGTTGTTGGCCATCAACGAAAAGCTTCATAATCAAATTTAAATTCCGTATCAACTTCTGGACGGACATG
CTGGCAAAAATTGATTTCGGTTTGTACATGTCGTCTGATATCGCTTCCATAAAGTTCCATCCATTATGCTTAACAACAAATTGAGTTACCGGACGAGCGG
TATCTGGACATTTTCGGCATCACTAAATGCAAAATGTTTGTTGATTATTTGGCTGAGTGTCTAATTAGGGATACACAACTACCCTTTTTATATTGTATCT
CACGTATTATATCACGCTCATTTCCCTCGAGTCAGGTTCCACCGTGAACGAATCTGTATGCTGACCTAGACTTTGCTCTGCATCGAAATACTTGATCATG
TCACTAGATACTGTAGCTCACCAAGTAATTCTCGATGTGGAACTTTTAGGGTGAATATTATTTTCGAAACACATCATAATATCCGTATAATATTATCTTA
TCAGCTAAATTTTGCGCTGCAGTAAAAATACACTGCTAATGGGTTGATAAAGATCAATGATATCAACCAATAATACCGATCCACTACAGAAGTATGCAAT
GAGTGGTGAGCAGATAATTACATTACATGTTTGTATTTTGATGTAGCTAAAAGAAGACTAAATTGGATTCCTTAAAAGGAGATTAACTATATAAAATACA
GTTCTACTTTTTTATCTTGCTAAAAACCTTACTTTGTATTTAAACCTTC