Description :
From Genome Similarity Track
Location :
Scaffold_3622:1409- 2495
Sequence
1086 bases(100 bases per row)
CCTCGACTTCATATTCACCGGCAACTTGGTCTGGTTCCCAGCTGTCCTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAG
TACCAACCGAGTGTTCGGTCGACTGTTGAATTCATTGACAGCTTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGT
TCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATTGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCA
TGTACAGCCCACGCCCGGCTCCCAATCTCGAAAAAGAGATCTCGGTGGAGCTCTTTGCAGGGATCTTCCATCTCTTCCGAAGCTTCCTGGAGGGTTTGTC
GAGTGTTCGTTTCCACTTTGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGGCCTCATTATGCTTTTTAGCCCTTTCGCTCCTTTTCTACAGCCTGA
TAATCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATG
ACGACATTGCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATAC
TAGCTTCTCCGCGATTTCATCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCA
TTAGCCTGTGGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCGT
GCCTTATTAATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAAC
GAATCCCGTGAACGAACACTGACATAGGAGCAACGCCGTGTTGCCCCTACGCGATTGGGGTAGTGGGATCACAAAATCCATCGAGA