Description :
From Genome Similarity Track
Location :
contig_2:14089- 16722
Transcript NameFunction/comments
g475.t1hypothetical protein

Sequence
2633 bases(100 bases per row)
TCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAGTGTCTCGACGGGCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTG
TAGCGTCTCAGTCCCTGACCGAGACTTGCGCAGCTTTGCTCGCTTGCGCCGTTCACTTCTCGTGCGGAACCCGGCTCCGCGAGTTTCTTCTTGTCCAGGC
CCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCTCTTCGTCGTGCAGTC
CGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGCCTTCTTTACC
TGAACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCC
GATTGAATCAGGCCCTGCTGATTCGGTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGATCGGAGACAGCCGCATTCCGCG
CTGTCTCTGGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCCCTCTCTGTCGCGCTGCTGCTGCTGCTGCTACCGAAGCG
CACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATA
AGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATA
GACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGA
CCTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCAAT
GCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGCCCCTCTAGTTTTTTGTTAGCCCGTGACGATACCCAGT
ATCACCACGATGGCTCTTCGCCGCGTGCACAGGTGCTGTGCACTCGCGAGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCA
CGACGCTGCTGGGAACCAGCAGCCGTAGGTACATTGGTTTGGGACCTCCCGATGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGGCGTTCACATGCAG
TTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCA
TCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCAC
GCACGTCATACTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACT
CTTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACACAACCTTCGA
CAACGGGTCGACGATACGTCGAGTCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCTACGTAACTGCTTACGTGG
AGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGT
GTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAG
GTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCAAGGGCAGGTTCTCAGCCCCGCGTTCGTAT
TCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCA
CGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGATAAAGGAACCGAACGATAGCTTTGGT
GCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCT
ATTAAATGACTCTCATTAGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGGGTGGTCACCTGAATGTAT
CCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG