Description :
From Genome Similarity Track
Location :
contig_62:140860- 142229
Sequence
1369 bases(100 bases per row)
GATTTTAGAGGGACTAAGTATGGAACAAACACAATCCAATGCCTTGGGCTATCCAGTTCGCGATACCAACATGAGATGGGCTCGCTGGAGCAGTCAACGA
ATGCATGAGCTCCATCATGTATGTCGTGGCTCTGAGTGCCGCCACGTATTGAGAGACACCGACCGTGTTTCAGGTCCAAGCAAAGCACAACTGCAGTCCA
CTTAGTTTCATAAAACGCAAGGGCTAACCTCACTCTGTGCAATCACTGATTGCCAGTGCCCGCTGACTAGGCGGGCATGTTTAAGCACGCGCTACTGTCA
GCTTTCCGCATGGATTACCACCCATGCTCGTGAATAATCCACCGTTCGGTTCTTGACACTTGCAACTTAGCTGACTCTTTCATTTGCAAACTTGATCTCC
ACTCCTCCATTCGAAGGATGCTCCTCTACTTGCTGATGTCGTTGGTTATATCCTCCGTGCTTCCAAGTCTCAATGTCAGTGCAACACCTTATGCTGAAAC
AAGCCTCGGTGATTTTTCCAGTTCGCATAAATTCTCATTTCGAGGTAAGGGCGATGAAGTCGAAGAGAGAACGGGACTCTCCGTTTCCGCTATCGAGAAG
GCCAAAACGTTATTCTCCTCGTCGACAACCACTACCGAAAAGCTCTAGAAATGGGTCAGCAACGGCAAAAATGCGGATACCGTTTTCTCGCGCATGAAGC
TTAGCACCAAGTCCGGGGGTCTGCTGTTTTATGACCCGCAGTTCGCCGTGTGGATCAAGTACGTGGATGATTTGAGTGCCAAGCACCCGGTCAAAGCGAC
GTCGGCGATCTCACGCTGACGACTCAATACGGCGACGATGCACTGTATAAATTGCTTGAATCTGCGAAGTGGGTCTCAAGACAAGAAACTCTCGCGACCC
GGCTGCAAGCCGAGCAGATCCAGCACTGGGCTACCGTCGGAAAATCCCCCGACGACGTCTTTCGTCTGTTCGATCTCCAATGGACAGGAAATTCCATTCT
CACAAATCCGAAGTTTACCTCATGGACCACGTATGTGGACGACCTCAGCGCACTGAACCCGGAGAAGGCAGCATCGACGATCCCAACGTTGACGACTTAC
TACGGTGATGATATTTCTGTTCAAGATGCTTGATGCCGCCAAGAAGTCGGACGAAACAAAGAGCATCGCCACCAAGTTGGAGGCCCAGCAGCTTCAGGGA
TGGTTGAAGAGTGGGAAATCGCCGGACAGTGCTTTCGTTCAGATGGGGCTTGGCAACGTGGAGGATAATCTGATGGCGAGTCCGCTTTTCAGCACGTGGG
TCAAGTACCTGGATGATTTCAACGCACAATACCCCGCGGAGAAAACTGCTCTGTTTCATGTTTTAACGA