Description :
From Genome Similarity Track
Location :
contig_62:140834- 142203
Transcript NameFunction/comments
g11406.t1POM61848.1 Secreted RxLR effector peptide protein [Phytophthora palmivora var. palmivora
g11407.t1hypothetical protein

Sequence
1369 bases(100 bases per row)
GTAAAAAAAGTGATTTTAGAGGGACTAAGTATGGAACAAACACAATCCAATGCCTTGGGCTATCCAGTTCGCGATACCAACATGAGATGGGCTCGCTGGA
GCAGTCAACGAATGCATGAGCTCCATCATGTATGTCGTGGCTCTGAGTGCCGCCACGTATTGAGAGACACCGACCGTGTTTCAGGTCCAAGCAAAGCACA
ACTGCAGTCCACTTAGTTTCATAAAACGCAAGGGCTAACCTCACTCTGTGCAATCACTGATTGCCAGTGCCCGCTGACTAGGCGGGCATGTTTAAGCACG
CGCTACTGTCAGCTTTCCGCATGGATTACCACCCATGCTCGTGAATAATCCACCGTTCGGTTCTTGACACTTGCAACTTAGCTGACTCTTTCATTTGCAA
ACTTGATCTCCACTCCTCCATTCGAAGGATGCTCCTCTACTTGCTGATGTCGTTGGTTATATCCTCCGTGCTTCCAAGTCTCAATGTCAGTGCAACACCT
TATGCTGAAACAAGCCTCGGTGATTTTTCCAGTTCGCATAAATTCTCATTTCGAGGTAAGGGCGATGAAGTCGAAGAGAGAACGGGACTCTCCGTTTCCG
CTATCGAGAAGGCCAAAACGTTATTCTCCTCGTCGACAACCACTACCGAAAAGCTCTAGAAATGGGTCAGCAACGGCAAAAATGCGGATACCGTTTTCTC
GCGCATGAAGCTTAGCACCAAGTCCGGGGGTCTGCTGTTTTATGACCCGCAGTTCGCCGTGTGGATCAAGTACGTGGATGATTTGAGTGCCAAGCACCCG
GTCAAAGCGACGTCGGCGATCTCACGCTGACGACTCAATACGGCGACGATGCACTGTATAAATTGCTTGAATCTGCGAAGTGGGTCTCAAGACAAGAAAC
TCTCGCGACCCGGCTGCAAGCCGAGCAGATCCAGCACTGGGCTACCGTCGGAAAATCCCCCGACGACGTCTTTCGTCTGTTCGATCTCCAATGGACAGGA
AATTCCATTCTCACAAATCCGAAGTTTACCTCATGGACCACGTATGTGGACGACCTCAGCGCACTGAACCCGGAGAAGGCAGCATCGACGATCCCAACGT
TGACGACTTACTACGGTGATGATATTCTGTTCAAGATGCTTGATGCCGCCAAGAAGTCGGACGAAACAAAGAGCATCGCCACCAAGTTGGAGGCCCAGCA
GCTTCAGGGATGGTTGAAGAGTGGGAAATCGCCGGACAGTGCTTTCGTTCAGATGGGGCTTGGCAACGTGGAGGATAATCTGATGGCGAGTCCGCTTTTC
AGCACGTGGGTCAAGTACCTGGATGATTTCAACGCACAATACCCCGCGGAGAAAACTGCTCTGTTTCAT