Description :
From Genome Similarity Track
Location :
Scaffold_4:1408197- 1410177
Transcript NameFunction/comments
Phyin_T30-4PITG_03322Prolyl-tRNA synthetase%2C putative

Sequence
1980 bases(100 bases per row)
GTGTGCGCCACACAAATAATCGCCACTCATTCGTGCATTGCTGGTCAAAATGTGGGCGGTTCGCGCTCGTCGCAGACTGCAAGGAGCTGCTATCCGCGGC
TCCTTCGTGTCGACGTTGCAGTCGATCCGTGCTGCCCCTTGTGCGTTGAGGTCCGTGCTGTGGGCTCCCACAGAGAAGCAGGCGCCGTCAGACGCTGCGG
TGCCCAGCCATCAACTACTGGTGCGGGCTGGTTTTGTGCGCAAAGGCGGCCACGGACTCTTTGCGCTGCTACCGCTCGGCCGTCGCGTGGTAGCCAAGCT
GGAGGCGCTAATCGACGATGAGATGTGCAAAATCGGTGGCAACCGCGTGGACCTCACGGTGCTGACACCCAACGAGCTGTGGAAGCAGTCGGGCCGGTGG
CAGAGTCGCGGTCCGGAGCTTATGACGCTTGAAGATCGACGCGAAGACCTGCTGATTCTGGGTCCCACACACGAGGAAAGCATCACAAGTCTCGTGGCGG
CCCATTACAATGCAGCAGGGACGGCAGACTCGTCCTTGAGACTGTATCAGATAGGCCGCAAGTTTCGTGACGAGATCCGTCCACGATTTGGATTATTGCG
AGCGAGAGAGTTCGTGATGAAGGACATGTATTCTTTTGATACATCGTATGAAAAAGCGCTGCAGACGTACGAGGACGTCACTGCTGCATACAATGAGATC
TTGATCTCAAGACTCAAGTTGCCGGTCAAACGTGTGGAGGCAGATTCTGGAAATATTGGCGGCAATCTGTCACACGAGTTTCACGTGCTGGCGGATGTTG
GTGAAGACGCAATTCTGTCCTGTTCGTCGTCGGAGTGTGACTACGCGGCCAATGTGGAGAAGGCGGAGGGAAACCTGCCAGTGTCGAGTGAGGAGCTTAG
TGACGAAGTCTCAGCGGAGCTTAACGGAGTCATTGCGCGGCTCCAGGACCAGGCTCGCACAGGTGAAGGACAAGTGTGGGAAACAGTAATGGAGCTTCAG
CAGGTTGCAGTTTCGCAGGGTTTCTCGGTCAAATTCGTTCACGAGCAGGAACAAACTGATGATCCTGAGGCTGTCAAGAAGAACGTCGAGGTTAGCTCAG
TGCCTCGTATGGCATTGTGCTTTGCTCGGCATGATCGTGAAGTGAATGAACTGACAGCTAAACCGTTCATCGGTGGTGATGAAGGTGAAGTGATCGTGAA
CCAGGCAAAGATCGCAGATTTGCTAACAAAGCGTGACCCAACATCGGAGTTGCATTTGCTGCTGGATGATTCTTTGAAACAGAGTAATAACGCTTCCGTG
GAGGCTCTTTGTGCCGCTGCAGAGACTCTATCAAAGTATCAGAAACATACACATCTTGCTTGGGGACACTTCCGTTTGGCGCAAGCTGGTGACTGTTGCC
CACGCTGCAACAGCGGTGGCGCTGCGGTGCTTGAGGACAAGCGTGGCATCGAGGTCGGTCACGTTTTCTACCTTGGACAGAAATACTCGAAGCCATTTGG
TGCGACGTACACGGATGCCAAGAACAACAAAGTTTCGCTAGAAATGGGCTGCTACGGTCTTGGTGTTAGTCGACTGGTCGCTGCGGCTGTCGAGGCTTCA
CACGACGACCACGGAATCGCGTGGCCTATGGAGATTGCTCCGTACAAGGTTCTTGTTATGTCAATTGGAGGAAAGAAACAGGACGATCCCGTATCCCAGG
CTGCATGGTATGTTGCTGGCAAGCTTGCTTCTGGTGATGTGGCTGGTTTGGTAAGAGACGATGTTCTGCTTGACGATCGCTGGCGAGAAAGCCCTGGGTC
GAAGTTGGCCGAATCGGAGCTTATCGGTTACCCATACCGTGTCGTCGTGGGCAAGCGTTTTACGAAGGAAGGTCTTGTTGAGGTGCAAACGCGAGCTACG
ATGGAGAAGACCTTTTTGACGCCAGACGAGCTGCCAACTTTTTTTGCTAGCCTTGTTGAAGCTGACAAGTTCTAGATCTA