Description :
From Genome Similarity Track
Location :
contig_2:14079- 16710
Transcript NameFunction/comments
g430.t1hypothetical protein

Sequence
2631 bases(100 bases per row)
TCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAGTGTCTCGACGGGCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTG
TAGCGTCTCAGTCCCTGACCGAGACTTGCGCAGCTTTGCTCGCTTGCGCCGTTCACTTCTCGTGCGGAACCCGGCTCCGCGAGTTTCTTCTTGTCCAGGC
CCGGCCGTGGACAGTTGTTCCTTGTACTCACCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCTCTTCGTCGTGCAGTC
CGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGCCTTCTTTACC
TGAACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTACCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCC
GATTGAATCAGGCCCTGCTGATTCGGTTCACATCTTCTCCCAACGACTCTCGCAGTCGTTGGCGTTCGTTTGGGGTGATCGGAGACAGCCGCATTCCGCG
CTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCCCTCTCTGTCGCGCTGCTGCTGCTGCTGCTCCCGAAGCG
CACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATA
AGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATA
GACTTCGAGGTGTTTTCACTTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGA
CCTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTGGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCAAT
GCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTCTAGGTTTTTGATAGTCCGTGACGATATCCAGT
ATCACCACGACGGCTCTTCGCCGCGTGCACAGGTGCTGTGCACTCGCGAGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCA
CGACGCTGCTGGGAACCAGCAGCCGTAGGTACATTGGTTTGGGACCTCCCGATGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGGCGTTCACATGCAG
TTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCA
TCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCAC
GCACGTCATACTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCT
TCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACACAACCTTCGACA
ACGGGTCGACGATACGTCGAGTCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCTACGTAACTGCTTACGTGGAG
TTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGT
TGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGT
GGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCAAGGGCAGGTTCTCAGCCCCGCGTTCGTATTC
CATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACG
TGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGC
CAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTAT
TAAATGACTCTCATTAGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGGGTGGTCACCTGAATGTATCC
CTTAGTGCATGTTGCACTAAGGTAGGAGGTG