Description :
From Genome Similarity Track
Location :
Scaffold_42:140761- 141896
Sequence
1135 bases(100 bases per row)
AAGGCGATTCGAGACTGGATCGACGAGATGTTGAAAGCTGGAATCATACGGCCCTCAAAGTCACCGTACGCGGCACCGACATTCTGCGTTAGAAAGGCAG
TCGGTTGGCGTGTGGTTCATGATTTCCGTGGCATCAACGCAAAAATCCGCTTACCCTCGACGCCTGTACCCCGAAAGGAAGATATCTTTGATGCAATGCG
CCGTGGCAAGATGTTCTCAGCCATGGACCTGCTATGGGGCTTCTTTCAAGTCCGCTTACGAACCGAAGACCTCCCTTACACCGCCTTCACAACGCCGAAT
GGGCTATTTGAGTATTTGGTCACACCAATGGGCCTCTCCTGTAGTCCTGATGCGTTCAATCGCCTGATCCAGAAAGTTTTTGCCGAGCAGAGCAGCTTCT
GCAAGGCGTATTTTGACGATTTGTTTGTCTACACCGAGACTAATCATGTGGAAGATCACCTTGTTGCTCTCGAAAAGGTTTTAGAGAGGTGCAAGGCAGA
ACAACTTACGTCAAACTCTCGAAGTGTACATTCTGTGCGTCAGAAATTCCTTGTCTGGGCGATTTCATCGATAGTCGTGGTATTCGGATGGACCCCGACA
AGATAAGAGTGATCTAGAATTGGCCTACGCCTCGCACAAAACGTGAACTCCAGTCATTCCTCGGCACCAGTGTGTATGTACTCAAGTACTGCCCAGATTT
TGCAGAATTATCCGCGCCTCTCACTGAGTTGATTAAGGGAAAAACTCGAAAGGAGCAGCTCCAGTTCAACGAGCAGCACCGAAAGTGCTTTGAAGAACTC
AAGCGTAGACTATCGCAACCGCCAGTTCTCGCTCATCCTGACTTCGATCGAATGTTTTGCGTGAAAATGGATGCATCAGACTTCGCTGTAGGAGGATACT
TGTACCAGCTTGATGACAAAGGTGGAGAACAAATTATTGCTTATGGCGGCAGAAAGCTCAGCGAAGCGGAACTAAAATACCCAACTCGCGAAAAAGAGCT
TCTCGCAGCTCTGTTTGCAATGCACACGTGGCATGTGTACTTAATTGATAAACCTTTCATGATCAACACGGACCATCGCACACTGGAAACAATTCTTCAG
CAGAACACGTGTTCGCAGTGGCTCGCAAGATGGCT